ID: 954944886

View in Genome Browser
Species Human (GRCh38)
Location 3:54413678-54413700
Sequence CAGTCACTAAATGATTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954944886_954944887 10 Left 954944886 3:54413678-54413700 CCATTAAAATCATTTAGTGACTG 0: 1
1: 0
2: 1
3: 27
4: 256
Right 954944887 3:54413711-54413733 TATATTGTATTTTTAGTTCCTGG 0: 1
1: 0
2: 20
3: 277
4: 2044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954944886 Original CRISPR CAGTCACTAAATGATTTTAA TGG (reversed) Intronic
903627698 1:24743363-24743385 CAGTCACTTCAGGATTTTCATGG + Intergenic
904493194 1:30872750-30872772 CAGTGTCTAGATGATTTCAAGGG + Intronic
905219568 1:36435442-36435464 CAGTCTCTAAACTTTTTTAAAGG + Intronic
909534700 1:76723518-76723540 CAGTCAGTAAAAATTTTTAATGG + Intergenic
910021855 1:82600836-82600858 CAGTCACTAAAATATCATAATGG - Intergenic
911379237 1:97091524-97091546 CAGACAGAAAATGACTTTAAAGG + Intronic
911549027 1:99257000-99257022 CAGGCATTAATTGATTGTAATGG + Intergenic
912109370 1:106321283-106321305 CAGTCACTAAGGGATATTTATGG + Intergenic
921506197 1:215973546-215973568 CAGTCACTGAGTGATGTTTAGGG - Intronic
921858820 1:220018517-220018539 CAATAACAACATGATTTTAAGGG + Intronic
922054871 1:222032140-222032162 CTCTCACTAAATGATTTCTAAGG + Intergenic
924024742 1:239820300-239820322 CGGTTAGTAAATGATTTTTAGGG + Intronic
924028122 1:239859150-239859172 CAGTCCATAAATTATTTTAATGG - Intronic
924687819 1:246313345-246313367 CAGCCACTGAATGATTGTGAAGG + Intronic
1064241987 10:13638996-13639018 AAGTCACTTGATGATTTTGAAGG - Intronic
1068606728 10:59013397-59013419 TAGTGAATAAATGATTTGAAAGG - Intergenic
1069841871 10:71344887-71344909 CTGCCACTAAATGATATCAATGG + Intronic
1071098453 10:82007599-82007621 CAATAAATAAATGATTATAATGG - Intronic
1071427138 10:85570484-85570506 CAGTTACTTACTGATTATAAAGG - Intergenic
1071944162 10:90622617-90622639 CAGTAATTAATTGATTTTAAAGG + Intergenic
1073172810 10:101526252-101526274 CAGTCACTGAAAGATTTTTGGGG + Intronic
1073635388 10:105193009-105193031 CATTAATTAAATGATTTCAAAGG - Intronic
1073673557 10:105619357-105619379 CAGTCAGAAAATGATTGTCAAGG + Intergenic
1075011881 10:118878753-118878775 CATTTACTAAATCATTTTTATGG + Intergenic
1075933910 10:126323442-126323464 CAGCCTCCAAATGATTTTAAAGG + Intronic
1076294152 10:129371496-129371518 CACTCAGAGAATGATTTTAAAGG + Intergenic
1076638649 10:131899845-131899867 CTGTCAATAAATAATATTAATGG + Intergenic
1078641689 11:13102673-13102695 CAGTCTGTAAATGATGTTGAGGG - Intergenic
1079059722 11:17237724-17237746 CAGTCAGTAAATGAATGTAAAGG - Intronic
1079198139 11:18349199-18349221 CAGTAACTTAATGTTTTTACAGG + Intronic
1079740051 11:24046884-24046906 CATTTACAAAATGATTTCAATGG - Intergenic
1080964657 11:37200690-37200712 CTGTCACCAAATTATTTTGATGG + Intergenic
1084729326 11:71063249-71063271 CAGTCACTCAATGACTTTGACGG + Intronic
1085671526 11:78468998-78469020 CAGTGACTAAAGGGTTATAAAGG - Intronic
1085912033 11:80838485-80838507 CAGTTATTAAAAGATGTTAAGGG + Intergenic
1088289216 11:108218258-108218280 GAGTAACTAAATGAATTGAAGGG + Intronic
1089017633 11:115179754-115179776 CAGCTAGTAAATCATTTTAATGG - Intronic
1089986039 11:122815086-122815108 CAGATAGTAAATGATTTTTAAGG + Intergenic
1090318037 11:125814537-125814559 CACTCACTATATGATGATAAAGG - Intergenic
1090606899 11:128431134-128431156 CTGTCACTAGAGGACTTTAATGG + Intergenic
1090735004 11:129604941-129604963 CATTTACAAAATGATTTTGATGG - Intergenic
1090843372 11:130512083-130512105 CACCCACTGAATAATTTTAAAGG - Intergenic
1091815410 12:3434178-3434200 CAGTCCCTAAAGGGTTTTAATGG - Intronic
1092699201 12:11208619-11208641 AAGTCATTAAATTATTTTATGGG + Intergenic
1095205960 12:39441482-39441504 CAGTCATTAACTGGTATTAAAGG + Intronic
1095826345 12:46533798-46533820 CAGTCACTAAATAAATTGAATGG - Intergenic
1096768950 12:53920234-53920256 CAGTAACCAAAGGGTTTTAATGG - Intergenic
1097441054 12:59609213-59609235 GAGATACTAAATGATTTTTAGGG + Intronic
1098549169 12:71744384-71744406 CAGACACTAAAGGATAATAAGGG + Intergenic
1098710680 12:73756296-73756318 GACTCACTAAATGATCATAAAGG + Intergenic
1099331051 12:81287922-81287944 CAGTGAGTAGATAATTTTAAGGG - Intronic
1100360532 12:93875152-93875174 AAGTCACTAAATAATGTTAAAGG - Intronic
1101238937 12:102818756-102818778 CTGACATTAAATGGTTTTAATGG - Intergenic
1106055195 13:26230787-26230809 CAGTAATTAAGTGGTTTTAATGG + Intergenic
1106183139 13:27385370-27385392 CAGCCACTAAATTATTTTAGGGG + Intergenic
1106808054 13:33331786-33331808 CACTCAATAAATGTTTTTCATGG + Intronic
1107769329 13:43773212-43773234 CAGTCATTGAAGGGTTTTAAGGG - Intronic
1108559666 13:51630103-51630125 CAGTAACTCAATGTCTTTAATGG - Intronic
1109448352 13:62474829-62474851 CAATCACTAGAGGGTTTTAAAGG + Intergenic
1109507145 13:63318286-63318308 CAGTCACAATATTATTTTTATGG - Intergenic
1109536296 13:63724265-63724287 CAATCACTACATGATATCAAAGG + Intergenic
1109539804 13:63762021-63762043 CAATCACTACATGATATCAAAGG - Intergenic
1109601606 13:64638210-64638232 CAGTCTGTAATAGATTTTAAAGG - Intergenic
1110103595 13:71641172-71641194 CAGTAAATAAATGTTTTTCAAGG + Intronic
1110385677 13:74907490-74907512 GAGCCACTAAATTGTTTTAATGG - Intergenic
1110798954 13:79672698-79672720 CAGTCACTAAATGAAGTCAACGG - Intergenic
1112158112 13:96839610-96839632 AAGTCACTAAAACACTTTAAGGG + Intergenic
1112607760 13:100923968-100923990 AAGTGAATAAATAATTTTAAAGG - Intergenic
1112956732 13:105068913-105068935 AAGTCACTACACGACTTTAAAGG + Intergenic
1116195676 14:41722714-41722736 AAGTCAGTAAATGATTCTTATGG + Intronic
1116854522 14:49939763-49939785 CAGTCAGTGATTTATTTTAACGG - Intergenic
1117061207 14:51965826-51965848 CAGACACTAAATGATTTACAGGG + Intronic
1117125752 14:52623419-52623441 CACTCACTGAAGCATTTTAAAGG - Intronic
1117982457 14:61355613-61355635 TATACACTAAATAATTTTAAGGG + Intronic
1118820610 14:69343075-69343097 CACTCAGTAAATATTTTTAATGG + Intronic
1118947778 14:70403866-70403888 CAGTAACAAAATGGCTTTAAAGG + Intronic
1119438915 14:74615237-74615259 CAGACAAGAAATGATTTTATAGG - Intergenic
1119999711 14:79289321-79289343 CAGCCAATAATTAATTTTAATGG - Intronic
1120296005 14:82642097-82642119 AACTCTCTAAATGATCTTAAAGG - Intergenic
1120417640 14:84240140-84240162 GATTCACTAAGTGATTTTACTGG - Intergenic
1121377466 14:93426644-93426666 AATTCACTAGATGATATTAATGG - Intronic
1121994290 14:98589947-98589969 CATTCACTAAACAACTTTAAAGG + Intergenic
1122679120 14:103443491-103443513 GATTCACTAAATGATGGTAACGG + Intronic
1124986070 15:34616021-34616043 CAGAAACAAAATTATTTTAAGGG - Intergenic
1125239386 15:37556673-37556695 TAGTAACTCAAAGATTTTAATGG + Intergenic
1126139775 15:45427882-45427904 CAGACATTAGATGATATTAAAGG - Intergenic
1126180232 15:45778035-45778057 CAGTCACTAGATGCTATTACAGG - Intergenic
1127406699 15:58656048-58656070 TAGTCACTATATAATTATAAAGG - Intronic
1127844240 15:62855767-62855789 AAATCAATACATGATTTTAAGGG + Intergenic
1128765581 15:70249124-70249146 CAATCACTGAAAGAGTTTAAAGG - Intergenic
1129085861 15:73091111-73091133 CAGTCACTAAAAAATTGTAAAGG - Intronic
1130207062 15:81886909-81886931 CAATCCCCAAATGATTTTAGAGG - Intergenic
1130321005 15:82841727-82841749 CAGTTACTGAATTATTCTAAAGG - Intronic
1132492991 16:244263-244285 CGGTCGGAAAATGATTTTAATGG + Intronic
1135401120 16:22166735-22166757 GATTCACTAAATGATTCTACAGG - Intronic
1135551559 16:23402101-23402123 GAGACACTAAATGAATCTAAAGG - Intronic
1135606548 16:23830872-23830894 AAATCACTAAATGGTTTCAAAGG - Intergenic
1139400822 16:66680115-66680137 CAATCAATAAATGATACTAAAGG - Intronic
1140613481 16:76630990-76631012 CAGACACTGAATGTTTTTATTGG + Intronic
1143496100 17:7313491-7313513 CATTCAGTAAAAGATTTTAATGG - Intronic
1146094125 17:29911962-29911984 CTGTCACTCAATGATTAAAATGG + Intronic
1149676403 17:58467152-58467174 CAGTAACAAAATAATTTTAAAGG + Intronic
1151809043 17:76425267-76425289 TGGTCACTAAAAAATTTTAAAGG + Intronic
1154404082 18:14072231-14072253 CAATCACTACTTGATTTTGATGG + Intronic
1155121341 18:22822938-22822960 CAGTTATTGAAAGATTTTAAGGG - Intronic
1155460553 18:26077124-26077146 CTATCACTTAATGGTTTTAATGG - Intronic
1156060938 18:33075663-33075685 CAATAACTACATAATTTTAAAGG - Intronic
1156348540 18:36282307-36282329 TAGTGACTAGATTATTTTAATGG - Intergenic
1156406815 18:36790689-36790711 TAGTCACTACTTTATTTTAAAGG - Intronic
1158126897 18:54110145-54110167 CTATCAATCAATGATTTTAATGG - Intergenic
1161730847 19:5959669-5959691 CAGGCAATAAATGATGTCAAAGG + Intronic
1165576199 19:36821230-36821252 CAGTGACTCAATGAATTGAAAGG + Intronic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
928669538 2:33587094-33587116 GATTCACAAAATGATTCTAAGGG + Intronic
929072191 2:38043226-38043248 TGGTCACTACATAATTTTAAAGG - Intronic
929824634 2:45300695-45300717 CAGCCTCTAAATGAATTTAGAGG + Intergenic
930214762 2:48683354-48683376 AATTTACAAAATGATTTTAAAGG - Intronic
930889922 2:56372812-56372834 CAGTCAGTAGACAATTTTAAAGG - Intronic
931451925 2:62375147-62375169 TAGTCATTAAATCATTTAAAAGG + Intergenic
931524135 2:63133959-63133981 CAGTGACTAAATAACTTTATAGG - Intronic
932311811 2:70748863-70748885 AAGCCATTAAATAATTTTAAAGG + Intronic
933032527 2:77349183-77349205 AAGTCAATAATTAATTTTAATGG - Intronic
933612602 2:84453006-84453028 CAGTCTCTATATGAATTTTAGGG - Intronic
939392623 2:141588430-141588452 AAGTCATTAAATGAGTTGAATGG + Intronic
939622725 2:144440029-144440051 AAGTGGCTAAATGTTTTTAAAGG + Intronic
940187363 2:151002176-151002198 CATTCACTAAATAATTTTAATGG + Intronic
941008782 2:160274565-160274587 CAGCTACTAGATGAATTTAAGGG + Exonic
941558673 2:167016853-167016875 AAGTCACTAAACTACTTTAATGG - Intronic
941582122 2:167311715-167311737 TATTCACTGAATGAGTTTAATGG + Intergenic
942128311 2:172849725-172849747 CAGTCACTAAGAGATCTTAGTGG - Intronic
942588376 2:177511785-177511807 CTTTCAGTAAATGATTTTTAGGG - Intronic
943637970 2:190326958-190326980 CAGTCACAAAATGGTGTTATAGG + Intronic
943902667 2:193460987-193461009 CACTCCCTTAATGATTTAAAAGG + Intergenic
944451855 2:199851365-199851387 TAGTCAATTAATGACTTTAAAGG + Intergenic
946640220 2:221775848-221775870 CTGGCACATAATGATTTTAATGG - Intergenic
946762746 2:223011292-223011314 GACTCATTAAATGATTTTCAAGG - Intergenic
946920702 2:224578927-224578949 CATTCATTAAATGAAGTTAAGGG - Intronic
947865191 2:233392578-233392600 AAGTTACTAAATGAATTTTATGG - Intronic
1172607339 20:36222830-36222852 AAGTCACTGAATGTTGTTAAGGG + Intronic
1173625712 20:44471361-44471383 CAGTCACTGAATGCTTTCATTGG - Intergenic
1174257902 20:49272066-49272088 CAGTCAGAACATGAGTTTAAAGG + Intronic
1175001629 20:55635383-55635405 AAGTCATTAAATGTTTTAAATGG - Intergenic
1177602367 21:23332723-23332745 CAGTTACTAAATAAGTTTAGAGG - Intergenic
1177815571 21:25972696-25972718 CAGTCTCTAAGACATTTTAAAGG + Intronic
1179132505 21:38651143-38651165 GAGTCACTTCATGCTTTTAAAGG - Intronic
949747730 3:7314134-7314156 GAGGTATTAAATGATTTTAAAGG - Intronic
951584602 3:24202907-24202929 CAGTCACAAAAGTAATTTAAGGG + Intronic
952934601 3:38386367-38386389 CAGGCAATAAATATTTTTAAAGG + Intronic
953286126 3:41611599-41611621 CAGTCACTAGAAGATTGAAAGGG - Intronic
954944886 3:54413678-54413700 CAGTCACTAAATGATTTTAATGG - Intronic
956277040 3:67513530-67513552 TATTCACTAAATGGTTATAAGGG + Intronic
956571468 3:70701295-70701317 CAGTTATCAAATGATATTAAGGG - Intergenic
957254152 3:77815012-77815034 CAGCTATTAAATTATTTTAAAGG - Intergenic
957594508 3:82244879-82244901 AACTCCCAAAATGATTTTAAAGG + Intergenic
959259553 3:104058481-104058503 CAAACACTGAATGATATTAAGGG + Intergenic
959820800 3:110733130-110733152 CAGTCACAAAATGAGCTTAAGGG + Intergenic
961941363 3:130640366-130640388 CAGTAAGTAGATTATTTTAAAGG - Intronic
963447074 3:145426031-145426053 CATTAATTAATTGATTTTAAAGG - Intergenic
963797081 3:149641677-149641699 CATTAAAGAAATGATTTTAAAGG - Intronic
964170419 3:153763858-153763880 CAGTAGCTAAATTATTTTCATGG + Intergenic
965996872 3:174894105-174894127 AAGTCACTATATCATGTTAAAGG + Intronic
966294838 3:178407500-178407522 AAGTCATTAACTCATTTTAAAGG + Intergenic
969240987 4:5897414-5897436 AAATCACTACATGATTATAAAGG + Intergenic
970287468 4:14533912-14533934 CAGTCACTAAATGAGATTCTGGG + Intergenic
970973070 4:22007790-22007812 CAGTCACTAAATGCTTGAAGGGG + Intergenic
971068506 4:23062973-23062995 CAGCCACCAAATGGATTTAAAGG + Intergenic
973894583 4:55398508-55398530 AATTCACTAATGGATTTTAATGG + Intronic
974077778 4:57183477-57183499 TAGTCAATTAATGATTTGAAAGG + Intergenic
974546980 4:63324092-63324114 CAGTCACAAAATAATTTCAGTGG + Intergenic
976865128 4:89716173-89716195 CATTCACTAAAATTTTTTAATGG - Intergenic
977056935 4:92204468-92204490 TAATCCCTAAAAGATTTTAATGG - Intergenic
977356226 4:95951059-95951081 CAGTCAGGAAATATTTTTAATGG - Intergenic
977562464 4:98546431-98546453 CACTCATTAAATCATTTTCATGG - Intronic
977984669 4:103368694-103368716 TAATGACTAGATGATTTTAATGG - Intergenic
980207039 4:129733275-129733297 GAGACACTTAATGATTTTGATGG - Intergenic
980746515 4:137023879-137023901 CAGTCACTAATTTAATTTCAAGG - Intergenic
981996870 4:150984592-150984614 CTGTCAATAAAAGATTTAAAAGG + Intronic
983309661 4:166042993-166043015 AAGCCACTAAAGGTTTTTAAAGG + Intronic
983314141 4:166105792-166105814 TAGCCACTAAATAATTTTTAGGG - Intergenic
983570784 4:169206309-169206331 GGGTCACTAAATGATTGCAAAGG - Intronic
986064397 5:4221731-4221753 CAGACACAAAATATTTTTAAAGG - Intergenic
986290835 5:6397545-6397567 CATGCACGAAGTGATTTTAAGGG - Intergenic
987454994 5:18132843-18132865 CAGTCAGTGATTGATTTTAGTGG + Intergenic
988956004 5:36320346-36320368 CAGTCACTATATAATGATAAAGG - Intergenic
989335683 5:40314414-40314436 CAGTCAATACATGAATTTTAGGG - Intergenic
990121158 5:52453824-52453846 CAGAAATTAAATGATATTAAGGG - Intergenic
991316573 5:65315330-65315352 CAGCAACTAAAATATTTTAAAGG + Intronic
991527115 5:67572387-67572409 CAGCCACTAAATGTTTTGATTGG + Intergenic
993102582 5:83559347-83559369 CAGACACTGAAGAATTTTAAGGG - Intronic
993233385 5:85269510-85269532 CAGTAAGTAAATTATTTGAATGG + Intergenic
993361076 5:86977149-86977171 CAGGCAGTACATGACTTTAAAGG + Intergenic
993518780 5:88872210-88872232 CAGTTATTAGATGATTTTAATGG - Intronic
994385970 5:99132331-99132353 CTGTCACAAAATGCTTTCAAAGG - Intergenic
995333543 5:110973436-110973458 CATTCAGAAACTGATTTTAAGGG - Intergenic
995351828 5:111185973-111185995 CAATCACTAAAATATTTTAATGG + Intergenic
996113959 5:119598190-119598212 CAGTCAGTCAGTGATTTAAATGG + Intronic
996926681 5:128835315-128835337 CAGTCAACAAATGATTTTGTAGG - Intronic
1000239024 5:159392035-159392057 CAGTCACTAAAAGTTTTGATGGG - Intergenic
1003181938 6:3799601-3799623 CACCCACTAAATGATTTGAATGG + Intergenic
1004124177 6:12856164-12856186 CAGTGACTTAATGAGTTGAATGG - Intronic
1004661414 6:17713538-17713560 TAGTCACAAAATCATTTTTAAGG + Intergenic
1004867233 6:19866035-19866057 TTGTCACTTAATAATTTTAAAGG - Intergenic
1006598002 6:35207561-35207583 GAGCCACTACAAGATTTTAAAGG + Intergenic
1009450345 6:63792446-63792468 CATTCCCTAAATGATTGTAAAGG - Intronic
1009723102 6:67501460-67501482 GGATCACTAAATGATTTTCATGG + Intergenic
1009738509 6:67711663-67711685 CAGTCACTATGTAATTATAAAGG - Intergenic
1009786123 6:68341863-68341885 GAGTCACAAAATATTTTTAAAGG - Intergenic
1011092089 6:83614998-83615020 CAAGCATAAAATGATTTTAAAGG + Intronic
1012394224 6:98777456-98777478 CAGTCTCTAAATCATTTTCATGG + Intergenic
1012650047 6:101741210-101741232 AATTCACCAAATGATTCTAATGG + Intronic
1013958259 6:115866330-115866352 CATTCCCTAAAGAATTTTAAAGG + Intergenic
1015181123 6:130364299-130364321 CAGTCACTCAATGCTTAAAATGG + Intronic
1015848654 6:137549102-137549124 CAGTGACTAGATAATTTTGAAGG - Intergenic
1016073021 6:139763220-139763242 AAGTCACTGAATGTTTTTGATGG - Intergenic
1016153178 6:140770003-140770025 CTGTCACTAAATATTTCTAAGGG - Intergenic
1017354606 6:153488625-153488647 CACTCTCTTAATCATTTTAAAGG + Intergenic
1018845982 6:167556225-167556247 CATTCACTAAAGATTTTTAAAGG - Intergenic
1019018528 6:168898565-168898587 CAGTTAATAAATCATTTTGAAGG - Intergenic
1020294169 7:6746610-6746632 CAGTCACAAAATGCTTTTTGGGG - Intergenic
1020373253 7:7457583-7457605 CAGTATATAAATGATATTAAAGG + Intronic
1023341359 7:39224159-39224181 CAGTGACTTTATGATTTTGAGGG - Intronic
1024364640 7:48507103-48507125 CGTTCACTTAATGATTTTCAGGG + Intronic
1024373612 7:48613741-48613763 CTTTCACTAAGTAATTTTAAAGG + Intronic
1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG + Intronic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1026587544 7:71668639-71668661 CAGTCAAACAATGACTTTAAAGG - Intronic
1027557223 7:79680465-79680487 GTGTCACAAAATGATTTAAAAGG - Intergenic
1027995961 7:85425514-85425536 AAGTTACAAAGTGATTTTAAGGG - Intergenic
1028213774 7:88107100-88107122 GAGTCACTAAATTATATTGATGG - Intronic
1028383856 7:90230212-90230234 CAGTCAGTATATGATTGTACTGG + Intronic
1028809719 7:95070422-95070444 CTTTCACTAAATAATTTCAAGGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1029854124 7:103496310-103496332 CATTCAATAAATCATGTTAAAGG - Intronic
1032039079 7:128543570-128543592 CAGGAAATAAATGACTTTAAAGG - Intergenic
1034144976 7:148861665-148861687 CACTCACTAATTTTTTTTAAAGG - Intronic
1034201931 7:149288037-149288059 CAGTCACTAGTTGACTTTAAAGG + Intronic
1034285961 7:149883139-149883161 CAAACACTAAATGATTTTGACGG + Intergenic
1037265222 8:17051628-17051650 CAGAAAATAAATGATTTCAAGGG + Intronic
1037322963 8:17660993-17661015 CTTTCACTAAATTCTTTTAAAGG - Intronic
1037533570 8:19803589-19803611 AATTCACTAGATGAATTTAAAGG + Intergenic
1038080383 8:24128369-24128391 CTGTCCCTAAAAGATTTGAAAGG - Intergenic
1038486768 8:27941015-27941037 CAATCACAATATGATTTTATGGG + Intronic
1040980696 8:53243423-53243445 CAATCAAGAAATGATTTTGAAGG + Intronic
1042469464 8:69167810-69167832 CCGTCACCAAATGATTCTATAGG + Intergenic
1042748789 8:72135611-72135633 CAGTCACTGAATTATGATAATGG - Intergenic
1042896244 8:73671724-73671746 CTGGCACAAAATGATTTTGATGG - Intronic
1043707264 8:83366741-83366763 CCTTCACTAAATTATCTTAATGG - Intergenic
1043735964 8:83744539-83744561 AAGTAAATAGATGATTTTAATGG - Intergenic
1044355616 8:91219486-91219508 CAGTCACAAAGTGATATTAGGGG - Intronic
1046301444 8:112297280-112297302 AAGTCCTTAAATGATTATAAAGG + Intronic
1046549146 8:115690870-115690892 CAGTCACTAAATATTACTAAAGG - Intronic
1047452227 8:124974922-124974944 CAATCACTAACCTATTTTAAGGG - Intronic
1047686454 8:127309558-127309580 CAGTTACTAAATTTTTGTAATGG - Intergenic
1047892066 8:129323809-129323831 CAGACACTATCTGATTTTTATGG - Intergenic
1051271076 9:15355467-15355489 CCTTTACTAAATGAATTTAAGGG + Intergenic
1051412600 9:16806063-16806085 CAGTCCCAAAATGATTTAAAAGG + Intronic
1051662306 9:19437299-19437321 GAGTCCCCAAATGATTTTAATGG + Intronic
1051701548 9:19829427-19829449 CACTCAATGAATGATTTGAAAGG + Intergenic
1052507285 9:29371828-29371850 CAGTGACTATATGAGTTTAAAGG - Intergenic
1052617492 9:30860245-30860267 CATTCACTAATTGATTTTCTAGG + Intergenic
1053575606 9:39355749-39355771 GAGGCACTAAGTAATTTTAAAGG - Exonic
1053840123 9:42183706-42183728 GAGGCACTAAGTAATTTTAAAGG - Exonic
1054097176 9:60914454-60914476 GAGGCACTAAGTAATTTTAAAGG - Intergenic
1054118582 9:61190083-61190105 GAGGCACTAAGTAATTTTAAAGG - Exonic
1054589175 9:66992481-66992503 GAGGCACTAAGTAATTTTAAAGG + Intergenic
1058474801 9:105322026-105322048 CATTCACAAAATAATTTGAAAGG + Intronic
1058768060 9:108201503-108201525 CAGTCACTATATAATGATAAAGG + Intergenic
1059982258 9:119785815-119785837 CATTCTCAAAATGGTTTTAAAGG + Intergenic
1186626751 X:11302734-11302756 CATTCTCTAAATGATTGTAATGG - Intronic
1187710963 X:22054014-22054036 TAATCACTAAATGACTTTATAGG - Intronic
1188025557 X:25205172-25205194 CAGTCAGTAAATCATTGTTAAGG + Intergenic
1188694407 X:33172260-33172282 AACTCAATAAATTATTTTAATGG - Intronic
1189648430 X:43160175-43160197 CAGTCACAAAATAATTTGAGAGG + Intergenic
1193385199 X:80862059-80862081 CAGTCACTATATAATGATAAAGG - Intergenic
1194429412 X:93782537-93782559 AAGTCACTGCATGATTTTAAAGG + Intergenic
1195717799 X:107834281-107834303 CAGTAACTAAATGGTTTGGAAGG + Intronic
1196509937 X:116497614-116497636 CAGTCACTATATAATGATAAAGG - Intergenic
1196630098 X:117928265-117928287 CTCTCAATAATTGATTTTAAAGG + Intronic
1197535692 X:127686664-127686686 AAGTCACTATATAATTATAAAGG - Intergenic
1198894270 X:141434144-141434166 AAGCCACTAAAGGATTTTATAGG - Intergenic
1199062861 X:143379546-143379568 CAGACACCAAATATTTTTAAAGG + Intergenic
1199811547 X:151354789-151354811 CAGTCATTCAATCATTTTATGGG - Intergenic
1200324093 X:155219589-155219611 TATTCACAAAATGATTTTACAGG - Intronic
1200740825 Y:6852144-6852166 CATTCTCTAAATGATTGGAATGG + Intergenic