ID: 954948572

View in Genome Browser
Species Human (GRCh38)
Location 3:54448480-54448502
Sequence CAGTTCCCCCAAACGAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954948563_954948572 30 Left 954948563 3:54448427-54448449 CCAAGCACTCTCACTCTGTCTCT 0: 1
1: 0
2: 7
3: 132
4: 1363
Right 954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 85
954948568_954948572 -4 Left 954948568 3:54448461-54448483 CCCTGGGTTATATTCCCATCAGT 0: 1
1: 0
2: 1
3: 32
4: 314
Right 954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 85
954948569_954948572 -5 Left 954948569 3:54448462-54448484 CCTGGGTTATATTCCCATCAGTT 0: 1
1: 0
2: 1
3: 7
4: 107
Right 954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 85
954948567_954948572 -3 Left 954948567 3:54448460-54448482 CCCCTGGGTTATATTCCCATCAG 0: 1
1: 0
2: 3
3: 8
4: 128
Right 954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 85
954948566_954948572 0 Left 954948566 3:54448457-54448479 CCTCCCCTGGGTTATATTCCCAT 0: 1
1: 0
2: 0
3: 7
4: 141
Right 954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954948572 Original CRISPR CAGTTCCCCCAAACGAAAGT AGG Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
901190128 1:7404750-7404772 CAGCTGCCCCAAAGGAAAGGAGG - Intronic
901493391 1:9607930-9607952 CAGTTCCCCCCAAAGAAATGGGG + Intronic
902518412 1:17002176-17002198 CAGTTCCCCCAGCTGAAAGTGGG - Intronic
903654979 1:24943489-24943511 CAGTTTCCCCAACTGTAAGTGGG - Intronic
907909617 1:58814900-58814922 GAGTTTTCCCAGACGAAAGTGGG + Intergenic
919134236 1:193488567-193488589 CAGTTCCCACATGCTAAAGTTGG - Intergenic
922814245 1:228438035-228438057 CAGGGCCCCCAAATGAAAGGGGG + Intergenic
924201213 1:241660809-241660831 CACTGCCCACAAATGAAAGTGGG + Intronic
1063810882 10:9705497-9705519 CAGATACCACAAACAAAAGTAGG - Intergenic
1070043712 10:72808903-72808925 CAGGTCCCCCTACCGAAATTGGG + Intronic
1072755822 10:98020063-98020085 CAGATCCCCCACAGGAAAGGTGG - Intronic
1081726750 11:45335286-45335308 GAGTTCCCCTAAACCAGAGTGGG + Intergenic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1082903005 11:58276616-58276638 CAATTCCCCCAAATGTAATTGGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1087169971 11:95040701-95040723 CAGTGCCCCAAAACCATAGTTGG + Intergenic
1101280554 12:103250583-103250605 GAGTTCCCCCAAAGGACAGAGGG + Intronic
1114189143 14:20428029-20428051 CAGTTTGCCCAAAAGAAAGAAGG + Intergenic
1125744579 15:41989674-41989696 CAGTTCCCCCAAAGGACACATGG + Intronic
1128254158 15:66184878-66184900 CAGTTCACCCAAACCAAGGCAGG + Intronic
1128659220 15:69485493-69485515 CAGCTACCCCAACCGAAAGCAGG - Intergenic
1133426089 16:5690886-5690908 CAGTTCCCCCAAACAAATCAGGG - Intergenic
1134807958 16:17141591-17141613 CAGTGCCCTCATATGAAAGTTGG - Intronic
1153377001 18:4392065-4392087 CAATTTCCCCTGACGAAAGTGGG + Intronic
1157496911 18:48162697-48162719 AAGTTCCCCCACAGGAAAATAGG + Intronic
934550814 2:95260487-95260509 CAGTGCCCCCAAATGAAGATTGG - Intergenic
934628778 2:95891448-95891470 CACTTCCCCCCATTGAAAGTGGG - Intronic
936987839 2:118328555-118328577 CAGGCCCCACAAACAAAAGTGGG - Intergenic
937028414 2:118718161-118718183 CAGATCCCCTAAATGAAAGAGGG + Intergenic
946166279 2:217866049-217866071 CAGATCCCCCAAAGGCAAGAGGG + Intronic
948394530 2:237634512-237634534 CAGTTCCCCCATAGGTAAGATGG + Intronic
1170590615 20:17768518-17768540 GGGTTCCCCCAAAGGAAACTGGG + Intergenic
1175083981 20:56443869-56443891 CAGATCCCCCAGGCGAGAGTGGG + Intronic
1178103521 21:29295542-29295564 CAGTTCCCCTACCCGAAAGTGGG - Intronic
1179823761 21:43952412-43952434 CAGTTCACCCTAACAAAAGGTGG + Intronic
1184053068 22:42023301-42023323 CAGTACCCCCCAACCAGAGTAGG + Intronic
950047040 3:9954965-9954987 CAGGTCCCCCAAAGGAAGTTAGG - Intergenic
950517816 3:13479301-13479323 CAGTTCCCTCAAGATAAAGTTGG + Intergenic
954926946 3:54244179-54244201 CACTTCTACCAAAAGAAAGTGGG - Intronic
954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG + Intronic
955578958 3:60397990-60398012 CGGTTCCCCTACCCGAAAGTGGG - Intronic
957255300 3:77828155-77828177 CAGATCCCCCAAAGAAAAGCAGG + Intergenic
959916589 3:111823233-111823255 CAGTTCCCCCTAATGAGAGCTGG + Intronic
960335623 3:116414136-116414158 AAATTCCCCAAAATGAAAGTTGG - Intronic
960623564 3:119659383-119659405 CAGCTACCCCAAACACAAGTGGG + Intronic
974083467 4:57235736-57235758 CAGTTCCCTCAAATGTAAATTGG + Intergenic
974381012 4:61139946-61139968 CAGTTGCCCCAAAGGAGAATAGG - Intergenic
977754736 4:100654688-100654710 CAGTTACACCACACTAAAGTTGG - Intronic
978078761 4:104566947-104566969 CAGGTACCCCAATCGAACGTAGG + Intergenic
979491915 4:121337919-121337941 CTTTTCCCCCAAATCAAAGTTGG - Intronic
979551986 4:122001846-122001868 TAGTTCCCCAAAAGGAAATTAGG - Intergenic
980753703 4:137127836-137127858 CAGTTCCCCAAAAAGACATTTGG + Intergenic
982247239 4:153365273-153365295 CAGTTCCCCAAAACAGAAGCAGG + Intronic
983911040 4:173239886-173239908 TAGTTCATCCAAACTAAAGTAGG - Intronic
993270026 5:85785034-85785056 CAATTCACCCAAAAGAAAATTGG - Intergenic
994612864 5:102067193-102067215 CAGTTCCCCCAAGAGAAGATTGG - Intergenic
995439817 5:112177871-112177893 CAGTTCACACAAAATAAAGTAGG + Intronic
1001570940 5:172730069-172730091 CAGTTTCCCTATACGAAAATTGG - Intergenic
1002547132 5:179956701-179956723 CAGCTCCCCCAAAGGTAAGGCGG + Intronic
1005354704 6:24970918-24970940 CAGTTTCCCCATCTGAAAGTGGG + Intronic
1005419912 6:25638301-25638323 GAGTTCGCCCAAAAGAAACTTGG - Intergenic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1014281628 6:119448058-119448080 CACTTCCCACAAAATAAAGTAGG + Intergenic
1016759731 6:147723756-147723778 CAGTTCCCTCCAAGGAAAGATGG - Intronic
1018208121 6:161454601-161454623 AAGTTCCCCCAAAATAAACTTGG - Intronic
1020735783 7:11947811-11947833 GACTTCCCCCAAATGATAGTGGG - Intergenic
1021213487 7:17886277-17886299 CTGTGCCCCCCAGCGAAAGTAGG - Intronic
1023791945 7:43759232-43759254 CAGTTTCCAAAAACGAAAGCGGG - Intronic
1028242793 7:88441340-88441362 AAGTTCCCCAAAATGGAAGTGGG + Intergenic
1032220367 7:129989843-129989865 CAGGTCCTCCACACGCAAGTGGG - Intergenic
1033548145 7:142421073-142421095 CAGGGCCCCTAAACGAAAGGTGG - Intergenic
1040289455 8:46116852-46116874 GAGATCCCACAAACGAAAATTGG - Intergenic
1040814338 8:51491799-51491821 AATTTCCCCCAAATTAAAGTTGG + Intronic
1046734268 8:117759693-117759715 CAGTGCCCCCAAATGGTAGTAGG + Intergenic
1047344836 8:124017407-124017429 CTGTTCCCCAAAACTAATGTTGG + Intronic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG + Intergenic
1054911713 9:70461061-70461083 CAGTTCTCTCAAACTCAAGTGGG - Intergenic
1055988827 9:82083275-82083297 CAGTTAGCCCAAGAGAAAGTTGG - Intergenic
1058820637 9:108726133-108726155 CAGTTCACCCAGAAGAAAGCAGG + Intergenic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1061880332 9:133565751-133565773 CAGTTCCCCCAGAAGGAAATCGG - Intronic
1062028767 9:134352585-134352607 CAGTCCCACCAAAGGAAAGCGGG - Intronic
1185760371 X:2685998-2686020 CAGATCCCCCCATAGAAAGTGGG + Intergenic
1194625058 X:96217544-96217566 AAATTCCCACAAAAGAAAGTGGG + Intergenic
1198862494 X:141085853-141085875 CAGTCCCCCGAAAGTAAAGTAGG + Intergenic
1198900200 X:141501533-141501555 CAGTCCCCCGAAAGTAAAGTAGG - Intergenic