ID: 954952744

View in Genome Browser
Species Human (GRCh38)
Location 3:54489611-54489633
Sequence CTGTAGATAAGGAGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954952744 Original CRISPR CTGTAGATAAGGAGCAGAGC TGG Intronic
901705443 1:11069731-11069753 CTGTAGATCAGGAACAGATGTGG + Intronic
903626123 1:24731376-24731398 TAGTAGGTAAGCAGCAGAGCTGG - Intergenic
903943945 1:26950228-26950250 CTGCTGAGAAGGAGCAGAGTGGG + Intronic
904727202 1:32558337-32558359 CTGTAGATAAGAAGGAGGGAGGG - Intronic
904797131 1:33065003-33065025 TTGTAAATATGTAGCAGAGCCGG + Intronic
906513084 1:46422715-46422737 CTGAAGATATGGGGGAGAGCTGG + Intergenic
906723388 1:48025452-48025474 CAGCAGATAAGCTGCAGAGCTGG - Intergenic
907183083 1:52587829-52587851 CTGTAGAAGGGGACCAGAGCCGG + Intergenic
908596962 1:65698219-65698241 CTGCAAATAACTAGCAGAGCGGG - Intergenic
910041337 1:82855314-82855336 CGGTAGATTTGAAGCAGAGCTGG + Intergenic
912188689 1:107312513-107312535 CTGTAGCTAAGTGGTAGAGCTGG + Intronic
912508263 1:110171496-110171518 CTGTAGATTAGTGGCAAAGCTGG + Intronic
912519011 1:110232726-110232748 GAGTAGACCAGGAGCAGAGCTGG - Exonic
914810993 1:151028010-151028032 CTGTAGAACAGGAGTGGAGCTGG - Intronic
916831060 1:168491686-168491708 CTGTAAATAAAGTGTAGAGCTGG - Intergenic
917624543 1:176832303-176832325 TTGTTGGTAAGGAGCAGAGCTGG + Intronic
918071845 1:181139197-181139219 CTGTAAATCCAGAGCAGAGCTGG + Intergenic
918205476 1:182304563-182304585 CTGGGGATAAGAAGTAGAGCTGG - Intergenic
919923583 1:202180470-202180492 CTGGAGATGGGGAGGAGAGCTGG + Intergenic
919992171 1:202715687-202715709 CTGTAGCTCAGGAGCAAATCTGG + Intergenic
920557868 1:206917375-206917397 CTGGAAATAAGAAGCTGAGCGGG - Intronic
921559930 1:216644885-216644907 CAGTAGGAAAGGAGAAGAGCAGG - Intronic
923937931 1:238784988-238785010 GGGTAGAAAAGTAGCAGAGCTGG + Intergenic
1063492262 10:6475326-6475348 CTGTTGATAAACGGCAGAGCTGG + Intronic
1063626625 10:7696379-7696401 CTGTTGACAGGGAGCACAGCTGG - Intergenic
1068789846 10:61016101-61016123 CTGCAGAACAGTAGCAGAGCAGG + Intergenic
1069790093 10:71013959-71013981 CTGAATATGAGGAGCAGAGGAGG + Intergenic
1070573243 10:77657506-77657528 CTGCTGATGAGGTGCAGAGCTGG - Intergenic
1072041632 10:91611969-91611991 CAGTTAATAAGGGGCAGAGCTGG - Intergenic
1075518511 10:123129247-123129269 CTGGAGATGGGGAACAGAGCTGG - Intergenic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1077324390 11:1957445-1957467 CTTTAGACAAGAATCAGAGCAGG - Intronic
1080308150 11:30858923-30858945 CTGAAGGTAGGAAGCAGAGCAGG - Intronic
1081491150 11:43569941-43569963 CTTTAGAGAAGGAGCTGAGTTGG - Intronic
1082760606 11:57123726-57123748 CCGTAACTGAGGAGCAGAGCCGG - Intergenic
1083402855 11:62436028-62436050 CTGTTTAAAAGGAGCAGAGCTGG + Intronic
1083545289 11:63545033-63545055 CTGTGGATTAGAAGCAGATCTGG - Intronic
1084570264 11:69955507-69955529 CTGAAGACCAGGAGGAGAGCCGG + Intergenic
1085274319 11:75288568-75288590 GTCTAGCTAAGGAGGAGAGCAGG - Intronic
1086415061 11:86580689-86580711 CAGTTAATAAGTAGCAGAGCTGG + Intronic
1089632647 11:119793366-119793388 CTGGGGATAAGAAGCAGAGACGG - Intergenic
1089836333 11:121373842-121373864 CAGTAGGTAAGGAGCTGAGTTGG - Intergenic
1089849241 11:121482190-121482212 ATCTGGAGAAGGAGCAGAGCAGG + Intronic
1202807371 11_KI270721v1_random:12622-12644 CTTTAGACAAGAATCAGAGCAGG - Intergenic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1092287798 12:7139485-7139507 CTGGAGATAAGTTGCAGAGATGG + Intronic
1092617468 12:10228630-10228652 CTCTAGTCAAGCAGCAGAGCTGG - Intergenic
1094165455 12:27438367-27438389 CTGGAGCTAAGGAGAAGATCAGG - Intergenic
1094488474 12:30943582-30943604 CTGCAGATTAGTAGCAGGGCAGG - Intronic
1094778003 12:33754459-33754481 TTGCAGAGAAGGAGCAGAGGAGG + Intergenic
1095949627 12:47774811-47774833 CTGTAGATAACGCGCAGAGATGG - Intronic
1096630666 12:52924983-52925005 CTGTGGAAAAGGAACAGGGCTGG + Intronic
1096749578 12:53750289-53750311 CAATAGATTAGGAGAAGAGCAGG + Intergenic
1096861557 12:54532401-54532423 TTGGAGAGAAAGAGCAGAGCTGG + Intronic
1098750440 12:74286217-74286239 CTCCAGATTAGGAGCAGAACAGG - Intergenic
1099232713 12:80045819-80045841 CCGCAGCTAAGTAGCAGAGCTGG - Intergenic
1099685360 12:85880510-85880532 CTGTGGATAAGAAGAAGTGCAGG + Intronic
1099914761 12:88878383-88878405 CTGTAGGAAGGAAGCAGAGCAGG + Intergenic
1100330754 12:93579766-93579788 CTGAAGTCATGGAGCAGAGCTGG + Intronic
1101415215 12:104502941-104502963 CAGTAGATGTGGGGCAGAGCTGG + Intronic
1102574298 12:113846316-113846338 GTGTAGATAAGGAGCACAGTTGG - Intronic
1103014918 12:117486735-117486757 CAGTAAGTAAGGAGCAGAGCTGG - Intronic
1103030479 12:117608112-117608134 CTGTTTGTAAGCAGCAGAGCTGG - Intronic
1103402455 12:120652498-120652520 CAGTCGATAGGAAGCAGAGCTGG + Intronic
1104401423 12:128479730-128479752 TTGCAAATAAGCAGCAGAGCTGG - Intronic
1107429046 13:40322339-40322361 CTGTACACAAGCAGCACAGCAGG - Intergenic
1108171062 13:47742491-47742513 ATGCAAAGAAGGAGCAGAGCTGG + Intergenic
1110742940 13:79018815-79018837 CCCTAGATATGGAGCAGAGAGGG + Intergenic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1114296802 14:21337197-21337219 ATCTAGTTAAGTAGCAGAGCTGG - Intronic
1114960658 14:27884068-27884090 CTGGAGAAAAGCAGCAGACCAGG - Intergenic
1115650535 14:35399651-35399673 CTACAGAAATGGAGCAGAGCTGG + Intergenic
1116128049 14:40814395-40814417 CTGTGTATGAGGAACAGAGCAGG - Intergenic
1117840238 14:59853262-59853284 CTGGAGATATGTAGCAGAGTTGG - Intronic
1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG + Intergenic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1120033034 14:79664232-79664254 CTGTAGATGAGGAGCAGTGAAGG + Intronic
1120631141 14:86892024-86892046 TTGTAGATAAGGAGTTGTGCAGG + Intergenic
1122154178 14:99740505-99740527 CTGCAGAGCAGGAGCACAGCAGG + Intronic
1122533538 14:102445783-102445805 CTGAAAATAAGGAGGAGAACAGG - Intronic
1122632021 14:103111555-103111577 CTGGAGGTCAGGAGCAGGGCAGG + Intergenic
1124102823 15:26711982-26712004 GTGCAGATCACGAGCAGAGCAGG + Intronic
1125236684 15:37522845-37522867 TTATAGAGAAGGAGCAGAGTAGG + Intergenic
1125758362 15:42081202-42081224 CTGGAGACAAGGAGCGGGGCAGG - Intronic
1125931585 15:43604099-43604121 TTCTAGAAAAGCAGCAGAGCTGG - Exonic
1125944689 15:43703579-43703601 TTCTAGAAAAGCAGCAGAGCTGG - Intergenic
1126668935 15:51098479-51098501 CTGTAGGTAAGCTGGAGAGCAGG + Intronic
1127393911 15:58528455-58528477 CAGTTAATAAGTAGCAGAGCTGG + Intronic
1129206275 15:74038718-74038740 CTGGATATAAGCTGCAGAGCTGG - Intronic
1129290581 15:74563949-74563971 CTGTAGAAAGCGGGCAGAGCAGG - Intronic
1131777809 15:95821634-95821656 TTGTTCATAAGGAGCAGAGATGG + Intergenic
1131871456 15:96768806-96768828 CTATGGAAAAGGAGTAGAGCCGG - Intergenic
1132203729 15:99972457-99972479 TTGCAGCCAAGGAGCAGAGCCGG - Exonic
1132563616 16:610393-610415 CAGCAGATGAGGAGGAGAGCAGG + Intronic
1133694779 16:8251922-8251944 GTGCAGATAAGGAACTGAGCAGG - Intergenic
1134475717 16:14571842-14571864 CAGGTAATAAGGAGCAGAGCCGG + Intronic
1135689413 16:24524083-24524105 GTGGAGAACAGGAGCAGAGCTGG - Intergenic
1141109263 16:81258567-81258589 CTCCAGGGAAGGAGCAGAGCTGG - Intronic
1141153617 16:81581833-81581855 CTGCAGAGAAGGAAAAGAGCAGG - Intronic
1141907284 16:87035385-87035407 CTTTAGAGATAGAGCAGAGCAGG + Intergenic
1144289631 17:13814005-13814027 TGGTTGATAAGAAGCAGAGCAGG - Intergenic
1144356410 17:14451101-14451123 CTGTAGATAGAGAGCAGGGCAGG + Intergenic
1144945564 17:18967934-18967956 CCAAAGATAAGGACCAGAGCCGG + Intronic
1145930495 17:28681897-28681919 CAGAAGATGAGGAGCAGAGGGGG + Exonic
1146775144 17:35607616-35607638 CTGGAGTTAAGCAGCAGAGAAGG - Intronic
1147387172 17:40089501-40089523 CTGGAGAGAAGGGGCAGAGCTGG + Intronic
1147461011 17:40568998-40569020 CTGTAGAAAATGGGCAGAGGTGG - Intergenic
1150179839 17:63106373-63106395 TTATAGCTAAGGAGCAGAGTGGG + Intronic
1151379779 17:73717693-73717715 CCCTAGAGATGGAGCAGAGCTGG + Intergenic
1152295958 17:79467047-79467069 GTCTAGATAAGGTGCAGAGCTGG + Intronic
1156388028 18:36624498-36624520 TCATGGATAAGGAGCAGAGCTGG + Intronic
1157670482 18:49524437-49524459 CAGGAGATAAGGAGCTGAACAGG + Intergenic
1158349290 18:56548648-56548670 CTGTTGATGAGAAGTAGAGCAGG + Intergenic
1158437309 18:57442576-57442598 ATGTAACTAAGGAGGAGAGCAGG + Intronic
1160554846 18:79718323-79718345 CAGCAGAGAACGAGCAGAGCCGG + Intronic
1162113505 19:8414016-8414038 CAGCACATAAGGAGTAGAGCTGG + Intronic
1162419031 19:10555317-10555339 CTGACGATAAGGAGCTGAACCGG - Exonic
1162644340 19:12037684-12037706 CTGCAGAGAAGAAGCAGAGTGGG - Intronic
1165125511 19:33593483-33593505 GTATTGATAAGGAACAGAGCAGG - Intergenic
1165329669 19:35134575-35134597 CTTTAGAGCAGGAGCAGCGCAGG + Exonic
1165607048 19:37114653-37114675 TTGTAAATATGTAGCAGAGCCGG - Intronic
1165762470 19:38329737-38329759 CTGGAGAGGTGGAGCAGAGCGGG + Intergenic
1165884521 19:39068329-39068351 GTGTGGAAAAGGACCAGAGCAGG + Intergenic
1166144362 19:40824036-40824058 CTGGAGATCAGAGGCAGAGCAGG + Intronic
1166183386 19:41124014-41124036 CTGGAGATCAGGGGCAGAGCAGG - Intronic
1166500793 19:43339634-43339656 CTGCTGGTAAGGTGCAGAGCTGG - Intergenic
1166699071 19:44871724-44871746 CCGCTGATAAGCAGCAGAGCTGG + Intronic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
925438255 2:3860193-3860215 CTGCAGATCTGGGGCAGAGCTGG - Intergenic
926020256 2:9488345-9488367 CTGTAGATAACAAGCAGATTTGG - Exonic
926955283 2:18288282-18288304 TTATAGACAAGGAGCAGAGTGGG + Intronic
927333039 2:21888746-21888768 CAGTTGATAAGTGGCAGAGCTGG + Intergenic
929577392 2:43060640-43060662 CTCCAGATAAGGAGCAGGGCTGG + Intergenic
929860773 2:45675627-45675649 ATGTTGAAAAGGAGCAGGGCTGG - Intronic
931227166 2:60341481-60341503 CTGGAGGTAAGTGGCAGAGCTGG - Intergenic
932593938 2:73082776-73082798 CTGTGGATAAGCACCAGTGCAGG - Intronic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
934751768 2:96798393-96798415 CTGGAGAGTAAGAGCAGAGCTGG - Intronic
935147967 2:100409134-100409156 CTGGAGGGAATGAGCAGAGCAGG - Intronic
935718009 2:105955402-105955424 CTGCAGAGAGGGAGCTGAGCAGG - Intergenic
936523630 2:113228076-113228098 ATGTAGAGGAGAAGCAGAGCCGG - Intronic
937236919 2:120436733-120436755 CTGGAGAAACGGAGCAGAGGAGG - Intergenic
939513082 2:143131532-143131554 CTCTAAATTAGGAGCAGAGCAGG - Intronic
939542132 2:143507457-143507479 CTGAAGATGGGGAGAAGAGCAGG - Intronic
940144525 2:150532352-150532374 CAGGTGAAAAGGAGCAGAGCAGG - Intronic
940568810 2:155404547-155404569 CTGTAGATAAAGACCAGAGGGGG - Intergenic
941279926 2:163537177-163537199 CTATAAACAAGAAGCAGAGCTGG - Intergenic
942493438 2:176512790-176512812 CTGTAGGTAAGTTGCAAAGCTGG - Intergenic
943467767 2:188250505-188250527 CAGTCAAGAAGGAGCAGAGCTGG - Intergenic
943829914 2:192447512-192447534 CCATAGAAAAGGAGAAGAGCAGG + Intergenic
946135892 2:217646619-217646641 CTTCAGATATGGAGCAGAGATGG + Intronic
947516594 2:230810729-230810751 CAGTAGAGCAGGAGCAGAGCCGG - Intronic
948565738 2:238884931-238884953 GTGTGGGTAAGGGGCAGAGCAGG + Intronic
1170137786 20:13094202-13094224 CAGTAAGTCAGGAGCAGAGCTGG - Intronic
1170178034 20:13494784-13494806 CTGCAAATAAGGAGCACAACAGG + Intronic
1170349420 20:15422806-15422828 ATCTATAAAAGGAGCAGAGCTGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173215505 20:41078501-41078523 CTTTAGACAAGGAGAAAAGCAGG + Intronic
1174864863 20:54125836-54125858 CAGTAGGTAAGTGGCAGAGCTGG - Intergenic
1175404491 20:58717543-58717565 CTGGAGGTGATGAGCAGAGCAGG + Intronic
1177423786 21:20896386-20896408 CTGTACAGAAGGAGCAAATCGGG + Intergenic
1179528532 21:42001139-42001161 ATAGAGATAAGTAGCAGAGCAGG + Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180624653 22:17186148-17186170 CTAAAGACAAGGAGCAGACCTGG + Intronic
1182892479 22:33830485-33830507 CAGCTGATAAGTAGCAGAGCTGG - Intronic
1182916453 22:34037187-34037209 CTGGAGATGAGGAGAAGAGTGGG + Intergenic
1183232308 22:36590654-36590676 CTGTAGAGAAGGATAAGAGTGGG - Intronic
1183456742 22:37927074-37927096 CTGCAGATCAGGGGCAGAGGAGG + Intronic
1184274748 22:43404028-43404050 CTGGGGAGAAGGAGCAGTGCTGG - Intergenic
949862464 3:8518694-8518716 CTGGAGATAAAGATGAGAGCTGG + Intronic
949936627 3:9121043-9121065 CAGTAAATTAGGAGCAGAACTGG - Intronic
951154770 3:19337678-19337700 CAGTAGACATGGAGCAAAGCTGG - Intronic
951851161 3:27141325-27141347 CTTTAGTTTAGCAGCAGAGCTGG - Intronic
953480200 3:43244833-43244855 CTGTAGCTAATGACCAGAGCAGG - Intergenic
953721757 3:45362241-45362263 CTGGAGATAAAGAGGAGGGCAGG - Intergenic
954201527 3:49026090-49026112 GTTTAGAGAAGGTGCAGAGCAGG + Intronic
954952744 3:54489611-54489633 CTGTAGATAAGGAGCAGAGCTGG + Intronic
955332589 3:58059950-58059972 GAGTTGATAAGCAGCAGAGCAGG - Intronic
957039004 3:75321667-75321689 CAGTTGATAAGTGGCAGAGCTGG - Intergenic
957481424 3:80802004-80802026 CTTTAGATAAGGAGAATTGCAGG - Intergenic
958470669 3:94513828-94513850 CTGTGGAGGAGTAGCAGAGCTGG - Intergenic
960987110 3:123287850-123287872 AGGTAGATAAGGAGCCGGGCAGG - Intronic
961041286 3:123680206-123680228 CTTGAGATGATGAGCAGAGCAGG - Intronic
961087165 3:124077875-124077897 CAGTTGATAAGTGGCAGAGCTGG - Intergenic
962384476 3:134921841-134921863 CTGCAGATGAGGAGCACAGGTGG + Intronic
964408870 3:156378129-156378151 CTGTAACTAAGGAACAGACCTGG + Intronic
964769840 3:160212621-160212643 CTGAGGGCAAGGAGCAGAGCAGG - Intergenic
965155965 3:165056166-165056188 CTGTCCATAAGGAACAAAGCTGG + Intronic
966994993 3:185270739-185270761 CTGTTGCTGAGGAGCAGGGCAGG - Intronic
967367825 3:188707796-188707818 CTGAAGAGAGGGAGCAGAGCAGG - Intronic
968603156 4:1519965-1519987 CTGGAGATAAGACGCAGAGCCGG + Intergenic
968902781 4:3439157-3439179 CTGCAGCTCAGGAACAGAGCTGG - Intronic
969097004 4:4741079-4741101 CTGTAGATACCGAGCAAATCAGG - Intergenic
969517269 4:7654679-7654701 GTGTGGATAAGCAGGAGAGCAGG - Intronic
970349410 4:15186365-15186387 CGGTAGATAGAGAGCAGAGGTGG + Intergenic
971444704 4:26730964-26730986 CTCTGGATAAGGAGTACAGCCGG + Intronic
972005967 4:34106286-34106308 CTGTAGATAATGAGTAGACAGGG + Intergenic
972410114 4:38785156-38785178 GTTTAGGTGAGGAGCAGAGCTGG - Intergenic
974422175 4:61690818-61690840 CTCTTGATAAGTAACAGAGCAGG - Intronic
975487088 4:74946190-74946212 CAGTAGATAAGTAACAGAACTGG + Intronic
975776914 4:77797262-77797284 CTGTAGATAAGGGACAGAGATGG - Intronic
975787768 4:77910766-77910788 CTTTAGAAATGGAGCAAAGCAGG + Intronic
976904551 4:90220286-90220308 CTGTAGATAAGGGGCAAATACGG + Intronic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978898685 4:113923217-113923239 CTGTAGAGAAAGAGAACAGCAGG - Intronic
979916499 4:126441318-126441340 CTGTTACTAAGGAGGAGAGCTGG - Intergenic
983991382 4:174124267-174124289 CTGTATGTAAGTGGCAGAGCTGG + Intergenic
984879712 4:184399688-184399710 CTGTAGAGCAGGAAGAGAGCTGG - Intronic
985122083 4:186654197-186654219 ATGTAAATAAGGAGCACAGCAGG + Intronic
985461509 4:190111805-190111827 TTGTAAATATGTAGCAGAGCCGG - Intergenic
986597907 5:9442436-9442458 CTGTGGAAAAGGTGCATAGCTGG - Intronic
987027566 5:13942761-13942783 TTGTAGCCAAGGAGCAGGGCAGG - Intronic
989704520 5:44312638-44312660 CAGAAGATACAGAGCAGAGCAGG + Intronic
990890503 5:60644104-60644126 CTGTGGATAAGGACCAGATTTGG - Intronic
991063943 5:62406035-62406057 CTGTAGAGAAGGAGCTGTGGAGG + Intronic
991360929 5:65819208-65819230 CTGTATATAAGTAACTGAGCTGG + Intronic
991407943 5:66319968-66319990 CTGGCCATCAGGAGCAGAGCTGG - Intergenic
991915131 5:71597931-71597953 CAGTAAGTAAGGGGCAGAGCCGG - Intronic
992868985 5:80987066-80987088 CTGTAGAAAAGGAGCTCATCTGG - Intronic
996312981 5:122127783-122127805 CTGGGGACAAGGAGCAGGGCTGG + Intergenic
997393246 5:133533922-133533944 ATGTAGATGAGGAGCACTGCAGG - Intronic
997925361 5:138025827-138025849 CTGAAGAAAATGAACAGAGCTGG + Intronic
999377401 5:151096225-151096247 CTGAAGCAAAGGCGCAGAGCTGG - Intergenic
1003553452 6:7119663-7119685 CGGTAGATAAGGGCTAGAGCAGG + Intronic
1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG + Intergenic
1005729573 6:28683936-28683958 TTGTAAATATGTAGCAGAGCTGG + Intergenic
1007252867 6:40508252-40508274 CTGCAGGTAAGGGGCAGATCAGG + Intronic
1008766998 6:54929926-54929948 CTGGAGATCAGGACCAGAGTTGG - Intronic
1008839358 6:55881439-55881461 CTGGAGATTAGGAGAAGAGATGG - Intergenic
1009193436 6:60656547-60656569 TTGTAAATATGTAGCAGAGCTGG + Intergenic
1009736316 6:67680511-67680533 TTGTAGTTAAGGAGTGGAGCTGG - Intergenic
1010535700 6:77026881-77026903 CTGTAGAAAAGTATCAGAACTGG - Intergenic
1012332880 6:98015771-98015793 CTATAGATAAGCAGCAAGGCAGG - Intergenic
1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG + Intergenic
1019713718 7:2529064-2529086 CTGGAGAGCAGGAGCAGTGCCGG + Intronic
1019801923 7:3094296-3094318 AAGGAGATAAGGAGCATAGCAGG - Intergenic
1022896658 7:34756832-34756854 CTTGAGAAAATGAGCAGAGCAGG + Intronic
1023204417 7:37732739-37732761 ATGTAACAAAGGAGCAGAGCAGG + Intronic
1024465298 7:49705911-49705933 CTGTAGAAAAGGAGGAGGGCAGG - Intergenic
1024613267 7:51085179-51085201 CTGAGGATAAGGAGGAGAACAGG - Exonic
1027839229 7:83286648-83286670 CTGTAAATAAGGAGTAGATGAGG + Intergenic
1029648114 7:101870994-101871016 CTGCAGATGAGTAGGAGAGCGGG + Intronic
1034867252 7:154652214-154652236 CTATGGCTAATGAGCAGAGCAGG - Intronic
1036425589 8:8642646-8642668 CTTTAGAAAAGGTGCAGAGGGGG - Intergenic
1039286040 8:36041955-36041977 CTGCAGAGTAGAAGCAGAGCAGG + Intergenic
1039369734 8:36972606-36972628 CAGCAGTTAGGGAGCAGAGCTGG + Intergenic
1039622304 8:39009527-39009549 CTGTAGAAAAGGAGGAAAACAGG - Intronic
1040457208 8:47610656-47610678 CTGTGGAGAAAGAGCTGAGCTGG - Intronic
1040547275 8:48408511-48408533 CTGTAGTTCTGGGGCAGAGCAGG - Intergenic
1042340280 8:67671570-67671592 CTTTAGTCAAGTAGCAGAGCTGG - Intronic
1042448429 8:68916811-68916833 CTGTAAATCAGAATCAGAGCTGG - Intergenic
1044748784 8:95396668-95396690 ATGTAGGTAGGGAGCAGAGGAGG + Intergenic
1045747633 8:105441847-105441869 CAGTAGAGAAGGGCCAGAGCAGG + Intronic
1046054577 8:109063817-109063839 ATGTAAATAAAGAGCAGAACAGG + Intergenic
1049361112 8:142212969-142212991 TTGGAGAGAAGGAGCAGAGGGGG - Intronic
1049597573 8:143491794-143491816 CCCTAGAGAAGGAGCAGAACAGG + Intronic
1049602004 8:143512300-143512322 CTGTTGATAAAAAGCAGATCAGG - Intronic
1050081346 9:1919165-1919187 CTTTAGATATAGAGCTGAGCGGG - Intergenic
1051104327 9:13561454-13561476 TAGTACGTAAGGAGCAGAGCTGG - Intergenic
1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG + Intergenic
1054722593 9:68617860-68617882 CTGTAGAAGGGGACCAGAGCGGG - Intergenic
1054824702 9:69561606-69561628 CTGTAGATAAGGAGTAGGTTTGG - Intronic
1057521217 9:95762142-95762164 CAGATGATAAGTAGCAGAGCTGG - Intergenic
1059284839 9:113163312-113163334 CTGTAGATAAGGCACAAAGCAGG - Exonic
1059612539 9:115914841-115914863 CTATAGAAAAAGAGGAGAGCTGG + Intergenic
1061154794 9:128851762-128851784 TTGTAAATATGTAGCAGAGCCGG + Intronic
1062312756 9:135948127-135948149 CGGTAGGTGAGGGGCAGAGCAGG + Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1185711397 X:2306406-2306428 CTTTGGACAAAGAGCAGAGCAGG + Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1187804486 X:23103902-23103924 ATGTTGATAAGGAGCTCAGCAGG - Intergenic
1188428249 X:30074628-30074650 ATGGAAATAAGGAACAGAGCGGG - Intergenic
1188647433 X:32587983-32588005 CTGTAGATAAGGAACAGAGCAGG + Intronic
1189169527 X:38895748-38895770 ATCCAGCTAAGGAGCAGAGCAGG - Intergenic
1192298810 X:69879279-69879301 CTGTAGAGAGGGAGAAGATCAGG - Intronic
1194405496 X:93491705-93491727 GTATAGGTAAGGAGCAGAGATGG - Intergenic
1196141413 X:112266931-112266953 CCTTAGATAGGGAGCAGAGATGG - Intergenic
1196747726 X:119086595-119086617 TTGCAGATAAGCAACAGAGCAGG - Exonic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic