ID: 954952838

View in Genome Browser
Species Human (GRCh38)
Location 3:54490375-54490397
Sequence GCCGGTTCCCGCTTCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954952823_954952838 30 Left 954952823 3:54490322-54490344 CCATCCCTGCGCAGCAGCAGGCT 0: 1
1: 0
2: 0
3: 43
4: 309
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952829_954952838 7 Left 954952829 3:54490345-54490367 CCCACGCCCTGGCTCTCCGGGCC 0: 1
1: 0
2: 1
3: 17
4: 265
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952825_954952838 25 Left 954952825 3:54490327-54490349 CCTGCGCAGCAGCAGGCTCCCAC 0: 1
1: 0
2: 4
3: 21
4: 309
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952831_954952838 1 Left 954952831 3:54490351-54490373 CCCTGGCTCTCCGGGCCATACCA 0: 1
1: 0
2: 1
3: 7
4: 120
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952832_954952838 0 Left 954952832 3:54490352-54490374 CCTGGCTCTCCGGGCCATACCAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952824_954952838 26 Left 954952824 3:54490326-54490348 CCCTGCGCAGCAGCAGGCTCCCA 0: 1
1: 0
2: 1
3: 21
4: 230
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952835_954952838 -9 Left 954952835 3:54490361-54490383 CCGGGCCATACCAGGCCGGTTCC 0: 1
1: 0
2: 1
3: 2
4: 93
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31
954952830_954952838 6 Left 954952830 3:54490346-54490368 CCACGCCCTGGCTCTCCGGGCCA 0: 1
1: 0
2: 1
3: 19
4: 296
Right 954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954952838 Original CRISPR GCCGGTTCCCGCTTCATGAA TGG Intronic
901452026 1:9341662-9341684 GCCTGTTCTCCCTTCCTGAACGG + Intronic
906558645 1:46736326-46736348 GCCTGTTACCTCTTCCTGAAAGG + Intergenic
915793632 1:158702802-158702824 GCCGGTTTCCTCTTCTTGTAAGG - Intergenic
1077367450 11:2166886-2166908 GACGTCTCCCGCTTCCTGAAGGG - Exonic
1077495165 11:2883819-2883841 GCCGGTTGCTGCTACATGAACGG + Exonic
1080026092 11:27616740-27616762 GCCGGTTTCTGCTTCTGGAAAGG + Intergenic
1080764902 11:35286816-35286838 GGCGGCTACCGCTTCATAAAGGG + Exonic
1083862583 11:65430319-65430341 GCTGATTCCCGTTACATGAAAGG - Intergenic
1099366648 12:81773276-81773298 GCCGGTTCCCACATGATGCAAGG - Intergenic
1100121306 12:91372514-91372536 GCTGCTTCCTGATTCATGAACGG + Intergenic
1111805250 13:93032422-93032444 GCCCATTCACGCTTCATGGAGGG - Intergenic
1122017311 14:98807394-98807416 TCCTCTTCCCGCTTCATCAATGG - Intergenic
1132756095 16:1486201-1486223 ACCGGCTCCCGCTTCAGGGAGGG - Exonic
1153275755 18:3366132-3366154 GAGGGTTCCAGCCTCATGAATGG + Intergenic
927215862 2:20667468-20667490 GCGGGCTCCGGCTTCAGGAACGG + Exonic
933707936 2:85305351-85305373 GCCGGTTCCTGCTTGACGATGGG - Exonic
943977157 2:194497901-194497923 GCAGGTTCCAGTTTCATGCAAGG + Intergenic
948205007 2:236159021-236159043 GCCGGTTCCCGCTGCAAGTGCGG + Intergenic
1169009562 20:2238850-2238872 GAGGGTTCCTGCTTCCTGAAAGG - Intergenic
1177592935 21:23195941-23195963 GCTTGTTCCTGCTGCATGAAGGG + Intergenic
1179170687 21:38970671-38970693 GCCGGTTCTCTCTTCTTGGAGGG - Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
951433198 3:22632040-22632062 GAGGGCTCCAGCTTCATGAATGG - Intergenic
954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
963645454 3:147908291-147908313 GAGGGTTCTCCCTTCATGAATGG + Intergenic
968691728 4:1993731-1993753 GCCCCTTCCAGCTTCATGGAAGG + Intronic
979987410 4:127331968-127331990 GAGGGTTCCCCCCTCATGAATGG - Intergenic
991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG + Intergenic
998783761 5:145686654-145686676 TCTGCTTCCCGTTTCATGAATGG - Intronic
1010022729 6:71179654-71179676 GCCGATTCCCCTTTCCTGAATGG - Intergenic
1051608274 9:18937624-18937646 GCAGGCTCCACCTTCATGAATGG + Intronic
1061679266 9:132234922-132234944 GCTGTTTTCCGCTTCTTGAAGGG - Intronic