ID: 954960746

View in Genome Browser
Species Human (GRCh38)
Location 3:54562711-54562733
Sequence CCACGCTGCTTGGCAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954960746_954960752 4 Left 954960746 3:54562711-54562733 CCAGTATCTGCCAAGCAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 86
Right 954960752 3:54562738-54562760 CCAGGAATTTTATTTCACTTTGG 0: 1
1: 0
2: 2
3: 29
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954960746 Original CRISPR CCACGCTGCTTGGCAGATAC TGG (reversed) Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
902995430 1:20221304-20221326 CCACGCTGCCTTCCAGCTACTGG - Intergenic
904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG + Intergenic
906408983 1:45564160-45564182 CCAGGCTCCTTGGCAGCTATAGG - Intronic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
918728083 1:187951063-187951085 CTGCGGTGGTTGGCAGATACAGG + Intergenic
1068608582 10:59033589-59033611 CCACTCTTTTTGGCATATACAGG + Intergenic
1071275702 10:84053121-84053143 CCCAGCTGCTTGGGAGATAGAGG + Intergenic
1072623812 10:97098364-97098386 CCAAGCTGCTAGGCAGAGAGGGG + Intronic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1080749653 11:35140076-35140098 CCACACTGATTGGCAGAAGCAGG - Intronic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1085803012 11:79608789-79608811 CCAAGCTCCGTGGCAGATACTGG - Intergenic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1102038572 12:109786318-109786340 CCCCACTGTTTGGTAGATACAGG + Intronic
1107203490 13:37751823-37751845 TCACTTTGCTTGGGAGATACAGG - Intronic
1114613360 14:24056033-24056055 CCACCCTGCTTGGTAGTTAATGG - Intronic
1117763505 14:59057797-59057819 CCAAGCTGGTAGACAGATACTGG - Intergenic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1123212473 14:106774109-106774131 CCATGCTGGATGGCAGATGCAGG + Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1124389847 15:29244595-29244617 CCACGCTGCTTCCCTGATCCAGG - Intronic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134764114 16:16741400-16741422 CCATGATGCTTGGCAAACACAGG - Intergenic
1134981943 16:18617809-18617831 CCATGATGCTTGGCAAACACAGG + Intergenic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG + Intergenic
1148229823 17:45924893-45924915 CCAAGCAGCTTGGAAGATACAGG - Intronic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1155491481 18:26405540-26405562 CCAAGCAGCTTGGCAGAGCCTGG + Intergenic
1159880597 18:73855177-73855199 CCTGGCTGCCTGGCAGCTACTGG - Intergenic
1159992563 18:74926893-74926915 CCACGGTGTTAGGCAGATAAAGG - Intronic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1166324570 19:42041432-42041454 ACACATCGCTTGGCAGATACTGG - Intronic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168649975 19:58086620-58086642 CCACCCTCCTTGCCAGATACAGG - Intronic
925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG + Intergenic
927047022 2:19289585-19289607 CCAAACTGATTAGCAGATACTGG + Intergenic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
932609710 2:73189830-73189852 CCACGGTGCTTAGCACATATTGG - Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
936399820 2:112156581-112156603 GCACGGTGCTGGGCAGGTACGGG + Intronic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
946428523 2:219612769-219612791 CCAAACTCCTTGGCAGACACAGG - Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1171397118 20:24842593-24842615 CCTCGCTGCTCAGCAGAAACAGG - Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1176024069 20:62977022-62977044 CCTCGCTGCTTGGTAGACCCTGG - Intergenic
1177047144 21:16184556-16184578 TCGCTCTGCTTGGCAGAGACTGG + Intergenic
1179985369 21:44918021-44918043 CCATTCTGCTTGGCACAAACTGG - Intronic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
953563112 3:44010513-44010535 CCATGCTGCTTGACACACACAGG + Intergenic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
964444673 3:156746262-156746284 CCCCACTGCTTGCCAGAAACAGG - Intergenic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
968921601 4:3524997-3525019 CCACGCTGATCTGAAGATACAGG - Exonic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
998041504 5:138953564-138953586 CCAGGCTGCTCTGCAGACACAGG - Intronic
1000276603 5:159742120-159742142 CCATGCTGCTAGGCACATATGGG + Intergenic
1001907645 5:175486336-175486358 CCAGGTTGCATGGCAGATGCTGG - Intronic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1006182514 6:32162877-32162899 CCAGGCTGTGTGGGAGATACCGG - Exonic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1012894074 6:104928969-104928991 TCATGCTGCTTTGCAGTTACAGG - Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG + Intronic
1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG + Intergenic
1034571655 7:151960947-151960969 CCACGCTGCTTGACAGAACTTGG - Intronic
1040445813 8:47492312-47492334 CCTGCCTGCTTGCCAGATACTGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1048980078 8:139698521-139698543 CCACCCTGCTTAGCACATGCAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1059021566 9:110581709-110581731 CCACGGTGCTTTGCACATAAAGG - Intergenic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic
1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG + Intergenic