ID: 954963132

View in Genome Browser
Species Human (GRCh38)
Location 3:54583794-54583816
Sequence CTTTGGGTCTTAAAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954963125_954963132 27 Left 954963125 3:54583744-54583766 CCTAATCTGTATAAGAAGACTTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG 0: 1
1: 0
2: 2
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954963132 Original CRISPR CTTTGGGTCTTAAAGACAAA AGG Intronic
903296396 1:22345784-22345806 CTTTGGGTCTTACAGAAGAATGG - Intergenic
906384981 1:45360293-45360315 CTTTAGCTCTGAAAGTCAAAAGG + Intronic
907173372 1:52493610-52493632 CTTGGGATTTTAAAGAAAAATGG - Exonic
907648532 1:56269255-56269277 CATTGGGTCTTGGAGAGAAAGGG + Intergenic
907669342 1:56461221-56461243 CTTATGGTCTTAAAGGAAAAGGG - Intergenic
908601451 1:65744380-65744402 CTTTGGGTAGTAAAGACCATGGG + Intergenic
909608932 1:77533023-77533045 TTTTAGGTATTAAAAACAAATGG + Intronic
910926059 1:92399299-92399321 CTTTTGGTCTGCAAGACATAGGG - Exonic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
912062945 1:105696906-105696928 ATTTGGGTAGTAAAGCCAAAGGG + Intergenic
913584370 1:120259129-120259151 CTCCAGGGCTTAAAGACAAAGGG + Intergenic
913623811 1:120639209-120639231 CTCCAGGGCTTAAAGACAAAGGG - Intergenic
914566367 1:148871006-148871028 CTCCAGGGCTTAAAGACAAAGGG + Intronic
914606452 1:149259234-149259256 CTCCAGGGCTTAAAGACAAAGGG - Intergenic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
920099550 1:203508408-203508430 CCTTGGGGCTCAAAGACACACGG + Intronic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921579299 1:216876475-216876497 CAATTGGTCTTTAAGACAAATGG - Intronic
1063691570 10:8292671-8292693 CTTTGGGTCTTCATGTCCAAAGG - Intergenic
1063887204 10:10591809-10591831 CTTTGGGTTCTAAATACACATGG - Intergenic
1064191352 10:13208610-13208632 TTTTGGGTTATAAAGAGAAAGGG + Intronic
1065362998 10:24906831-24906853 CTTTGGTTCTAAAAGGCACAGGG + Intronic
1066314674 10:34232705-34232727 CTTTGTCTCTAAAAGAAAAAAGG - Intronic
1067448750 10:46368621-46368643 CTTTGGGTCATGAACACAAGTGG - Intergenic
1067635748 10:48000235-48000257 CTTTGGGTCATGAACACAAGTGG + Intergenic
1067877749 10:50020086-50020108 CTTTGGGTCACAAACACAAGTGG - Intergenic
1067877767 10:50020153-50020175 CTTTGGGTCACAAACACAAGTGG - Intergenic
1070132307 10:73664242-73664264 CTTTGGGTCATGAACACAAGTGG + Intergenic
1071609373 10:87019834-87019856 CTTTGGGTCATGAACACAAGTGG - Intergenic
1071838322 10:89442001-89442023 CTTTGGGTCTCTCAGACTAATGG + Intronic
1072256745 10:93628665-93628687 CCTTGGGTCATAATCACAAATGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073056991 10:100709489-100709511 CTTTGTGTCTGCAAGACCAATGG - Intergenic
1074093505 10:110286363-110286385 CTTGGAGTTTGAAAGACAAAGGG - Exonic
1074713066 10:116193438-116193460 CTTTGGGAATAAAAGATAAAGGG + Intronic
1075623387 10:123944383-123944405 CTGTGGGTCTTTAAAACAAAGGG + Intergenic
1076133026 10:128026749-128026771 CTTTGCTTGTTAAAGAGAAAAGG - Intronic
1078470443 11:11581841-11581863 CTGTGGGTCTCAAAGAAAAGAGG - Intronic
1078778111 11:14412049-14412071 CTTTGGGTCTTAATAACTCAGGG - Intergenic
1079419609 11:20273731-20273753 CTTTTGGTTTTAAAAACAGAAGG - Intergenic
1081843184 11:46218496-46218518 CATCGGTTCTTAAAGACATATGG - Intergenic
1085112370 11:73899264-73899286 TTTTAGGTCTTAAACACAAAGGG + Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1088440132 11:109861193-109861215 GTTTGTGTCTTAGAGACTAATGG - Intergenic
1091618833 12:2070221-2070243 CTTTGGGTCTTAAAGGAATGAGG + Intronic
1094060106 12:26304726-26304748 TTTAGAGTCTTAAAAACAAATGG + Intergenic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1098430045 12:70409042-70409064 CTTTGGATCTAAAGGCCAAAAGG + Intronic
1098536967 12:71604053-71604075 CTTTAGGTTTTAAAGTCAAAAGG - Intergenic
1098702569 12:73647010-73647032 CTTTGGTTCTTAGCAACAAAGGG - Intergenic
1099874238 12:88384504-88384526 CTTTGGGACTTAGAGAAAAAAGG - Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1102112781 12:110377484-110377506 CACTGGGTCTTCAAGACAAACGG + Exonic
1102386795 12:112516752-112516774 CCTTGGGTCTTAAGGATATAAGG + Intergenic
1103957093 12:124583236-124583258 CTCAGGGTCAGAAAGACAAAGGG + Intergenic
1107096679 13:36545118-36545140 GTTTTGGTATCAAAGACAAAGGG - Intergenic
1108950050 13:56080756-56080778 CTGTGTGTCTTAAAGTAAAAAGG - Intergenic
1109594106 13:64526680-64526702 CTCTGGGGCTTAAACACAAGGGG - Intergenic
1110588192 13:77220277-77220299 CTGTGGGGCATAAAGTCAAAGGG + Intronic
1115246984 14:31305586-31305608 TTTTGGGTGTTAAAGACTGAGGG + Intronic
1115536693 14:34379754-34379776 CTTGGGGGCTGAGAGACAAAGGG + Intronic
1115834112 14:37378434-37378456 CTTTGGGACTTATATAAAAATGG - Intronic
1118028698 14:61798118-61798140 CTTTGAGTTATTAAGACAAAGGG - Intergenic
1118911614 14:70066491-70066513 ATCTGGGTCTTAAAGGCAGAAGG - Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1121822440 14:96982428-96982450 CTCTGGCTCTTAAATAGAAATGG + Intergenic
1122363671 14:101182131-101182153 CTTTGGGACTTAGAGACACTAGG - Intergenic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1125095858 15:35850419-35850441 CCTTGGGAAATAAAGACAAAGGG + Intergenic
1126397575 15:48235297-48235319 ATTTGGGTTTAAAAGAGAAAGGG - Intronic
1126893349 15:53230822-53230844 TTTTGGAGCTTAAAGAAAAAAGG + Intergenic
1129057573 15:72832038-72832060 ATGTGGGAATTAAAGACAAAAGG + Intergenic
1129065670 15:72901940-72901962 CTTTGGGTGGTGAAGAAAAATGG + Intergenic
1130379759 15:83361355-83361377 CTCAGGGCCTTAAAGACCAAAGG + Intergenic
1132229519 15:100171285-100171307 ATTTGGGTCTTAAAGAAGGAAGG - Intronic
1134182175 16:12056609-12056631 CAGAGGGTCTTAAAGACAACAGG - Intronic
1135112179 16:19698867-19698889 CTTTGAGTGATAAAGACAAAAGG - Intronic
1138477490 16:57280488-57280510 CTTTTGGTTTTAAAAAAAAAAGG - Intronic
1138920215 16:61518482-61518504 CTTTGGCTCTTAAAGAGAAGAGG + Intergenic
1138949128 16:61889315-61889337 ATTTGGGTCTAAAAATCAAATGG + Intronic
1142768359 17:2078847-2078869 CTTTAGGGCCCAAAGACAAAGGG + Intronic
1142967620 17:3591109-3591131 CTCAGGGTCTGAAAGACATAAGG + Exonic
1143694143 17:8598182-8598204 CTTTATGTCTTCAAGACACAAGG - Intronic
1145123053 17:20277984-20278006 CTTTGGTTCTGGAAGACACAAGG - Intronic
1145789402 17:27616602-27616624 CTTTTGCTCTTAAATACAACTGG - Intronic
1146963526 17:37005241-37005263 CTGTGGGTCTGTACGACAAAAGG + Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148570944 17:48668561-48668583 CTGTGGGGCTTCCAGACAAATGG + Intergenic
1149217462 17:54374387-54374409 CTTTGGGTATGAAAGTCAACAGG - Intergenic
1151621462 17:75247996-75248018 CTTTGGGTTCTGAAGACAAATGG + Intronic
1154032943 18:10769091-10769113 GTTAGGGTATTAAAGAGAAATGG - Intronic
1154261434 18:12836605-12836627 CTTTGAGTATTTAAGATAAAAGG - Intronic
1155148667 18:23105082-23105104 CTTTGGGTCTTAAATGCTGAAGG - Intergenic
1155419237 18:25636567-25636589 CTTTGGCTGATAATGACAAAAGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156735673 18:40255898-40255920 CTCTAGGTCTCATAGACAAAGGG + Intergenic
1158507280 18:58057858-58057880 TTTTGGGTCTAACAGACAACAGG + Intronic
1158568928 18:58580185-58580207 CTTTGGGTGTTAAAGGAACAAGG - Exonic
1158690618 18:59657038-59657060 CTTAGGCTGTGAAAGACAAAGGG - Intronic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1159978598 18:74748571-74748593 CTTTGGCTTTTAAAGTCAAAAGG - Intronic
1160003563 18:75051159-75051181 CTTTGGGTTTTAGAGACATTAGG - Intronic
1160657374 19:280510-280532 CTTTGGGCCTAAAGGACACAGGG + Intergenic
1162656474 19:12134979-12135001 CTTTGGGGCTTTCAGACCAAAGG - Intronic
925660896 2:6201391-6201413 CTTTCAGTCTTACAGACTAAAGG - Intergenic
926170989 2:10552520-10552542 CCTTGGCTCTTAAAGCCACAGGG + Intergenic
927111127 2:19864401-19864423 CTTGGGGTCTTGAAGACAAATGG - Intergenic
927452462 2:23220781-23220803 CATTTTGTCTTACAGACAAAGGG - Intergenic
927694341 2:25230159-25230181 CTCTGGGGCCTAGAGACAAAAGG + Exonic
934563180 2:95323654-95323676 CTTTGGGGCTTAAAGGCACCAGG + Intronic
936350842 2:111711419-111711441 CTCTTGGTTTTAAAGAAAAAAGG + Intergenic
936771898 2:115923744-115923766 CTTTGGGTCCTCAGGAGAAAGGG - Intergenic
937367116 2:121271254-121271276 CTTTTGCTTTTTAAGACAAATGG - Intronic
939750972 2:146045344-146045366 ATTTGGGTCTTCAAGAGAGAAGG + Intergenic
944290169 2:197995871-197995893 CTTTCTGTCTTAGTGACAAATGG + Intronic
944848678 2:203694799-203694821 CTTTGTGTCTTAAAAGCAAGGGG + Intergenic
948048171 2:234959136-234959158 AATTGAGTCTTAAGGACAAATGG - Intronic
1169470322 20:5879475-5879497 ATTTGGGTCTGTAAAACAAATGG - Intergenic
1173323580 20:42011623-42011645 CTTTGTGTCATAAAGAAAAACGG - Intergenic
1174890630 20:54388273-54388295 CTTTGGGGCTTAGAGACCAAGGG + Intergenic
1177879810 21:26678851-26678873 CTTGAGTTCTTAAAGAAAAAAGG - Intergenic
1179319191 21:40273589-40273611 AGTTCGGTCTTAAAGACACAAGG - Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1184674259 22:46031981-46032003 CTTTGGTTCTTAAAACAAAACGG + Intergenic
950400414 3:12765532-12765554 CTTTGGGTTCTAAAGAAAAATGG + Intronic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
957415483 3:79897345-79897367 CTTTGGGTTATAAAGTTAAATGG + Intergenic
959557886 3:107743522-107743544 CTTTGGATTTTAAAGAGTAATGG - Intronic
960295306 3:115935656-115935678 CTTTTCATCTAAAAGACAAAAGG - Intronic
963377183 3:144483179-144483201 CTTTGGTTCTTATAGGCAACAGG + Intergenic
963661019 3:148129323-148129345 CTTTAGCTCCTATAGACAAAGGG + Intergenic
965032911 3:163396467-163396489 CTTTGGGCCTGAAAGAACAAAGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
965948364 3:174270871-174270893 CTTTGCATCTTAAACATAAAAGG - Intronic
965994271 3:174860482-174860504 CTATGTGTCTTATGGACAAATGG + Intronic
966501499 3:180646617-180646639 CATGGTGTTTTAAAGACAAAGGG + Intronic
967224617 3:187279102-187279124 CTTTGCGTGTTAAATACAGAGGG + Intronic
971350020 4:25847136-25847158 CTTTGGAGTTTGAAGACAAAAGG - Intronic
972060673 4:34868154-34868176 CTTAGGGTTTTAAAGAAACATGG - Intergenic
972272181 4:37522396-37522418 CCTTGGGTCTTAAGGAAACATGG - Intronic
973218964 4:47703974-47703996 CTTTGGCTCATAAACAGAAAAGG + Intronic
974890644 4:67878412-67878434 CTTTGGGTAATCAAGATAAATGG - Intronic
975600140 4:76090502-76090524 CTTTGGATCTGAAAGAGATAGGG + Intronic
976885788 4:89982287-89982309 CCATGGGTCTTAATGGCAAATGG - Intergenic
979679827 4:123447301-123447323 CTTTGTGACTTACAGACAACAGG + Intergenic
980881225 4:138711866-138711888 GTCAGGGCCTTAAAGACAAAGGG - Intergenic
981661961 4:147178073-147178095 CTGTGCGTCTGAAACACAAAGGG + Intergenic
982679766 4:158415051-158415073 CTTAGGGTTTTCAAGATAAATGG + Intronic
983301989 4:165937324-165937346 CTTTGGCTCTCAAGGACACAGGG + Intronic
984182609 4:176503230-176503252 CTTTGTTTCTTCAAGAAAAATGG - Intergenic
984561703 4:181278485-181278507 ATGTGGGCCTTAAAGACATAAGG + Intergenic
985879235 5:2626028-2626050 CTGTGAGTCTTAGAGACAAAGGG + Intergenic
986776010 5:11014302-11014324 CCTTGGGACTTAAAAAGAAATGG - Intronic
986857626 5:11889127-11889149 CTTTGAGTCTTACAGAAAGAAGG - Intronic
987410152 5:17606799-17606821 CATTGTGTCTTAGAGACACAAGG + Intergenic
988939096 5:36123582-36123604 CTGTGGGTTTAAAAGACAATTGG + Intronic
989025947 5:37068636-37068658 ATTGGGGTCTTAAAAACGAAGGG - Intergenic
989148445 5:38272369-38272391 CCTTTGGTTTTAAAGACAAATGG - Intronic
989297850 5:39850764-39850786 TTTTGGTACATAAAGACAAAAGG - Intergenic
989519950 5:42389867-42389889 CTTTGGGTCTGATTGACAAAAGG - Intergenic
990693935 5:58393804-58393826 ATTTGAGTTTTATAGACAAAAGG + Intergenic
990979140 5:61586123-61586145 CTTTCGGTCTGAAGGACAAAGGG - Intergenic
991501076 5:67278431-67278453 CTTTGGCATTTAAAGACAGAGGG + Intergenic
992429805 5:76698426-76698448 CTTTGGCTAAAAAAGACAAAAGG - Intronic
995346589 5:111127206-111127228 CTTTAAGTCTTCAAAACAAAAGG - Exonic
995820877 5:116230759-116230781 CTTTGGATGGTAAAGAGAAACGG - Intronic
997622050 5:135305415-135305437 CTCTGGGTGCTAAGGACAAAGGG - Intronic
998649503 5:144102253-144102275 CTTTGGCCCTTAGAGACAAATGG - Intergenic
998827109 5:146113889-146113911 CTTTGGGTGTCCAAGAGAAATGG - Exonic
1001000913 5:168006197-168006219 CTTTGGCTTTTAAAGATAAATGG - Intronic
1001320614 5:170677796-170677818 CTTTGTTTCTTTAAGGCAAATGG + Intronic
1002150651 5:177227309-177227331 CTTATGGTCTTAAATACATATGG + Intronic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1006233324 6:32604484-32604506 CTTTGGGTGTTACCTACAAAAGG - Intergenic
1007987739 6:46224162-46224184 ATCTGGGTCTAAAAGACAAGCGG + Intronic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1009287090 6:61832659-61832681 TGTTAGGTCTTAAAGACAACTGG + Intronic
1013090368 6:106895002-106895024 GTTTGGGTATTAAAAGCAAAAGG - Intergenic
1014212127 6:118718568-118718590 CTTTAGGACATAAAGAGAAATGG + Intergenic
1016339111 6:143042096-143042118 CTATGGGTCTTCAAGAGAAAGGG - Intergenic
1016596352 6:145806016-145806038 CCTTGGCTCTTCAAGACCAAAGG - Exonic
1016633308 6:146257296-146257318 CTATGGGGCTTAAAAACAAGAGG - Intronic
1018217703 6:161546422-161546444 GTTTGGGATTTGAAGACAAAGGG + Intronic
1018341928 6:162859844-162859866 CTTTGGGTCTTAATTTCAGAAGG + Intronic
1018987144 6:168646478-168646500 CTTTGTCTTTTAAATACAAATGG - Intronic
1021242812 7:18225442-18225464 CTTTTTGTCATAAATACAAAAGG + Intronic
1021415143 7:20375633-20375655 GTTTGGGTGTTGAAGATAAAGGG - Intronic
1022380807 7:29858128-29858150 TTTTGGTTCTTAAAGTGAAATGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1027469866 7:78559990-78560012 CATGGGGACTTACAGACAAAAGG + Intronic
1032616093 7:133472675-133472697 GTTTGGGACTCAAAGACAGAAGG + Intronic
1033766780 7:144502236-144502258 CTTAGGCTCTTTAAGTCAAATGG + Intronic
1037250097 8:16882065-16882087 CTCTGTCTCTTAAAGAAAAAGGG + Intergenic
1037427591 8:18772995-18773017 GTTTGTGCCTTAAAAACAAAGGG - Intronic
1039339910 8:36636448-36636470 CCTTGAGTCTAGAAGACAAACGG - Intergenic
1040732462 8:50465343-50465365 CTTAAGGTCTGTAAGACAAAGGG - Intronic
1040943435 8:52855784-52855806 TTTTGGGACTTAAAGAGTAAGGG - Intergenic
1040960539 8:53027409-53027431 GATTGGGTCTCCAAGACAAAGGG + Intergenic
1042120550 8:65483323-65483345 ATTTTTGTCTTAAAGTCAAAAGG + Intergenic
1042400916 8:68345953-68345975 CTTTGGTTGTTAAATACAACTGG - Intronic
1042750776 8:72155283-72155305 CTTTGTATCATAAAGAGAAATGG + Intergenic
1044485339 8:92746173-92746195 CTTTGGCTCTTTAAGAGAATAGG - Intergenic
1045206914 8:100052831-100052853 ATTTGGGTCTTAATGGCAAGAGG + Exonic
1045387837 8:101688634-101688656 CTTTGGAAATTAAACACAAATGG - Exonic
1047103809 8:121710954-121710976 CTTTGGTTCTTCAAGAAATAGGG - Intergenic
1047354880 8:124111077-124111099 TCCTGGGTGTTAAAGACAAAAGG + Intronic
1047862435 8:128983213-128983235 CTTTGGGTCTTAGGTACACATGG - Intergenic
1048593117 8:135839941-135839963 CTTAGGGACTGTAAGACAAAGGG - Intergenic
1050254252 9:3777578-3777600 CTTGGGTACATAAAGACAAATGG + Intergenic
1050469274 9:5968904-5968926 CTTTGTGTATGAAACACAAAAGG - Exonic
1050629136 9:7540327-7540349 CTTTGGGTTTTCAACACTAATGG - Intergenic
1052176175 9:25465187-25465209 CTTTGTGGCTTATAAACAAAGGG - Intergenic
1055028870 9:71751741-71751763 CTTTGGGTCCTCATGACACATGG - Intronic
1057004155 9:91541736-91541758 CTGAGGGTCTTAATCACAAAGGG - Intergenic
1057195286 9:93112977-93112999 CTTGGGGTCTAGAAGACAAAAGG - Exonic
1058358189 9:104107745-104107767 CTTTGGGGCATGAAGACTAATGG - Intronic
1059069912 9:111124627-111124649 CATTAGGTCTGAGAGACAAAGGG + Intergenic
1060800287 9:126540206-126540228 GTTTGTGTCATGAAGACAAAAGG - Intergenic
1062149827 9:135012227-135012249 CTTTGGGTCTGGGAGTCAAAGGG - Intergenic
1187080571 X:15982400-15982422 CTTTGGGGCATAGAGAGAAAGGG + Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1187267747 X:17751278-17751300 ATTTGGTTCTTAAAGATAATGGG + Intronic
1188385117 X:29546995-29547017 CTTTGGGCTTTAAAGACATGTGG + Intronic
1192582130 X:72292683-72292705 CTTTGGGACTCAAAGACAGGAGG - Intronic
1192680064 X:73242786-73242808 CTGTGGGTCTTAATGACTAGTGG - Intergenic
1194141021 X:90209801-90209823 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1196368564 X:114950165-114950187 CTCTGGGTCTTTCAAACAAAGGG + Intergenic
1197427407 X:126314287-126314309 ATTTGTTTCTGAAAGACAAATGG - Intergenic
1198414956 X:136410728-136410750 CTTAGTGTATCAAAGACAAAGGG + Intronic
1198938807 X:141930764-141930786 CTTAGTTTCTTCAAGACAAATGG + Intergenic
1199041049 X:143115967-143115989 CCTTGGGTCTTAAAGGAACATGG - Intergenic
1200486786 Y:3778919-3778941 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1201289160 Y:12406156-12406178 ATTTGAGAATTAAAGACAAAGGG + Intergenic
1201736894 Y:17277179-17277201 CTTTGAGTAGTAAAGACATAGGG - Intergenic