ID: 954964698

View in Genome Browser
Species Human (GRCh38)
Location 3:54599992-54600014
Sequence CTGCTGGCACAGCCTGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 310}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954964687_954964698 28 Left 954964687 3:54599941-54599963 CCAGATGCCAGGTCCTATGTTGT 0: 1
1: 0
2: 0
3: 11
4: 145
Right 954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG 0: 1
1: 1
2: 1
3: 33
4: 310
954964689_954964698 21 Left 954964689 3:54599948-54599970 CCAGGTCCTATGTTGTGCTGGCC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG 0: 1
1: 1
2: 1
3: 33
4: 310
954964697_954964698 -8 Left 954964697 3:54599977-54599999 CCTGGCGGCATAAGTCTGCTGGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG 0: 1
1: 1
2: 1
3: 33
4: 310
954964695_954964698 0 Left 954964695 3:54599969-54599991 CCAAGGGACCTGGCGGCATAAGT 0: 1
1: 0
2: 1
3: 12
4: 197
Right 954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG 0: 1
1: 1
2: 1
3: 33
4: 310
954964692_954964698 15 Left 954964692 3:54599954-54599976 CCTATGTTGTGCTGGCCAAGGGA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG 0: 1
1: 1
2: 1
3: 33
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954964698 Original CRISPR CTGCTGGCACAGCCTGTGCA CGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900470761 1:2853854-2853876 CTGCAGACATAGCCTGTGTAGGG + Intergenic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900472501 1:2861720-2861742 CCCTTGGCACAGCCTCTGCAAGG + Intergenic
901690119 1:10967336-10967358 CAGAGGGCACAGCCAGTGCAAGG - Intronic
902097975 1:13962169-13962191 CTGTGGGAACAGCCTGTGCCGGG + Intergenic
903367394 1:22813539-22813561 GTGCTGGCAGAGGCTGTGGAGGG + Intronic
903658143 1:24961250-24961272 CCAGTGCCACAGCCTGTGCAGGG - Intronic
903952840 1:27006080-27006102 CTGCAGGCACTGGCTGAGCAGGG - Exonic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907509755 1:54949418-54949440 CTCCTGGGCCAGCATGTGCAGGG - Intergenic
908339359 1:63160813-63160835 CTGCTGGCACAGCTTGATCTGGG + Intergenic
913161760 1:116151868-116151890 CTGCTGTCACAGCCCCTCCATGG + Intergenic
914474709 1:148013689-148013711 CTCTTGGCACAGCCGGTCCAGGG - Intergenic
915185813 1:154104476-154104498 CTGCTGCCACTGCCTGGGAAAGG - Intronic
915473059 1:156137187-156137209 CTGCGGGAACAGCCTGCGTACGG + Exonic
916717317 1:167456251-167456273 ATGCCGGCACTGCCTGTGCCTGG + Intronic
919503895 1:198373569-198373591 CTGTTAGCTCAGCCTCTGCAGGG - Intergenic
920377503 1:205517050-205517072 CTGCTGGGACAACCTGTGCCAGG - Intronic
922406402 1:225318192-225318214 CTGCTTGCACAGCCTTGGAAGGG + Intronic
922753300 1:228081249-228081271 CTGCTGGCAGAGCGTGGCCAGGG - Intergenic
924055052 1:240116807-240116829 CTTCTGGCACATCATGGGCATGG + Intronic
924172537 1:241357084-241357106 CTGCCGGAGCCGCCTGTGCACGG - Exonic
1063114427 10:3063964-3063986 CTGCTGTTTCTGCCTGTGCATGG - Intergenic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1067246661 10:44553127-44553149 TAGCAGGCTCAGCCTGTGCATGG + Intergenic
1069861695 10:71475660-71475682 CTGCTGGCTTTGCCTGAGCAGGG + Intronic
1072755591 10:98018823-98018845 CTGGTGGCCCAGCCTGTGTGGGG - Intronic
1073070505 10:100790520-100790542 CTGCTTCCATAGCCTGTGCTTGG - Intronic
1074421229 10:113310172-113310194 CTGCTGGCTCATCCTCTGCCCGG + Intergenic
1074822618 10:117192246-117192268 AAGCTGGCACAGCCCATGCAGGG + Intergenic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1075498866 10:122954015-122954037 CTGCTGGCACCGCCTGCTCCAGG - Exonic
1075836236 10:125455141-125455163 CAGCTGCCACAGCTTGTGAAGGG - Intergenic
1076156115 10:128206998-128207020 CTGCTGGCCAGGCCTGAGCAGGG + Intergenic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1076693534 10:132236205-132236227 CAGGTGGCAGAGCCTGCGCACGG + Intronic
1077199431 11:1298036-1298058 CTGCTGGCATGGGCTGTGCCAGG - Intronic
1077310826 11:1888387-1888409 CAGCTGTCAAAGCCTGGGCATGG + Intronic
1078159325 11:8827292-8827314 CTGCTGGCACTAGCTGTGCGGGG - Intronic
1078599207 11:12715623-12715645 CTTCTGGCAAAGCCCCTGCAAGG - Intronic
1078743799 11:14091945-14091967 CTGCTTGCACTTCCTGGGCAAGG + Intronic
1078934322 11:15938553-15938575 CTGCTGGATCAGCATGTGCCAGG - Intergenic
1080700438 11:34639781-34639803 CTGCTGGCACTCCCTTTCCAAGG - Intronic
1080763363 11:35273739-35273761 CTTATGGCACAGGCTGGGCAGGG + Intronic
1081615538 11:44588645-44588667 CTGATGCCAGAGCCTGTTCAGGG + Intronic
1081794714 11:45811372-45811394 GTGCTGGCCCCGCCTGTGTACGG - Exonic
1083235124 11:61346226-61346248 GTGCTGGCAGAGCCAGGGCAAGG + Intronic
1083339545 11:61950191-61950213 CGGCTAGCACAGCCTGGCCATGG - Intronic
1083489688 11:63007123-63007145 CAAGTGGCACAGCCTATGCATGG - Intronic
1084441956 11:69179592-69179614 CTCCTGGCCCACGCTGTGCAAGG - Intergenic
1085516564 11:77115385-77115407 CTGCTGTCACTGCCTGTGGAGGG - Exonic
1088449015 11:109962829-109962851 CTGTTGGCTCAGTCAGTGCAGGG - Intergenic
1090428762 11:126628809-126628831 CCGCTCGCTCTGCCTGTGCAGGG + Intronic
1091822328 12:3484988-3485010 CTGCAGGCACAACCTCTGGAAGG + Intronic
1094167014 12:27453334-27453356 CTGCTGCCCCATCCTGTGCCGGG + Intergenic
1094338835 12:29388051-29388073 CAGATGGCACAGACTGTGCATGG - Intergenic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1097885027 12:64720428-64720450 CTGAAGGCACAGGGTGTGCAGGG - Intronic
1100024581 12:90112307-90112329 CTGCAGGCACAACCTGTGTGGGG + Intergenic
1101207515 12:102503521-102503543 CTGCTTTCACAGCCTCTCCATGG + Intergenic
1102174069 12:110863147-110863169 CTGGGGGCGCTGCCTGTGCACGG + Intronic
1103670882 12:122614183-122614205 CTCCTGTCACAGCGTGTGGATGG + Intronic
1104715967 12:131016441-131016463 CAGAGGGGACAGCCTGTGCAGGG - Intronic
1104716383 12:131019015-131019037 GTGGTGGCCCAGCCTGTGCCCGG + Intronic
1104962279 12:132493905-132493927 CTGCAGGCACACCCTGAGCCAGG - Intronic
1105438829 13:20399377-20399399 CTCCTAGGACACCCTGTGCATGG + Intergenic
1106287392 13:28329559-28329581 CTGTTCTCCCAGCCTGTGCAGGG + Intronic
1111556323 13:89885435-89885457 ATGTTGGCACAGCCTGGCCATGG + Intergenic
1113034726 13:106036884-106036906 CTGCTGGGAGAGCCTGGGAAGGG - Intergenic
1114065772 14:19059045-19059067 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1114096489 14:19340955-19340977 CTGCTCCCAGAGCCTGAGCATGG - Intergenic
1114453166 14:22839343-22839365 CTGATGCCACAGCCAGTGCCTGG - Intronic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117463755 14:55972306-55972328 CTGCTGGCAGCCCCTGTGAAGGG + Intergenic
1118023736 14:61746637-61746659 CTCCTGCCTCAGCCTGTGCTAGG + Intronic
1119348390 14:73944590-73944612 GTGCAGGCACAGGCTGTGCCCGG + Exonic
1119615604 14:76096807-76096829 GTGCTGCCACTGCCAGTGCAAGG + Intergenic
1121670747 14:95709172-95709194 CTGCTGCCATGGTCTGTGCAGGG + Intergenic
1121818029 14:96943291-96943313 CAGCTTGCCCAGGCTGTGCATGG + Intergenic
1122387633 14:101359898-101359920 CTGCTGGGACAGGCTCTGCCTGG + Intergenic
1122764270 14:104054715-104054737 CGGCTGGCACAGAGTGTGGAGGG + Intergenic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123118669 14:105906944-105906966 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123120894 14:105916562-105916584 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1124209914 15:27754062-27754084 CCCCTGCCACAGCCTGTCCAGGG - Intergenic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1124338107 15:28872445-28872467 GTGCTGGCACATCCAGTGCCTGG - Intergenic
1124429530 15:29594440-29594462 GAGCTGGCAGAGCCTGTACAGGG - Intergenic
1125495085 15:40185780-40185802 CTCCTGCCTCAGCCTGTGCTGGG - Intronic
1125527919 15:40390012-40390034 CAGCTGGCCCAGTATGTGCAGGG + Intronic
1125750517 15:42024496-42024518 CTGCTGGCAGAGGCAGTGCCTGG - Intronic
1125875111 15:43137534-43137556 CTGCTGGCACAGACTTAGCTAGG - Intronic
1126143773 15:45457684-45457706 ATTCAGGCACAGCCTGTGGAAGG + Intergenic
1128035215 15:64518909-64518931 GTGCTTGCACTGCCTGTGCTGGG + Intronic
1128974534 15:72140817-72140839 TAGCTGGAAAAGCCTGTGCATGG - Exonic
1129110744 15:73335707-73335729 TTGCTGTCAAGGCCTGTGCAGGG - Intronic
1130053554 15:80503746-80503768 GCTCTGGCGCAGCCTGTGCAGGG - Intronic
1130416711 15:83701316-83701338 CTCCTGGGAGAGCCTGTCCAAGG - Intronic
1130530197 15:84741353-84741375 CTGCTGGCTCAGCCAGTGGGAGG + Intergenic
1132214837 15:100054786-100054808 CTCCTGGCACAGGCTGTCCCTGG - Intronic
1132284683 15:100654325-100654347 CTGCTGGCAAATACTGTTCAAGG - Intergenic
1132731774 16:1366430-1366452 CAGCTGGCCCAGCCTGGGCAGGG - Intronic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1135250979 16:20900771-20900793 CTACTGGACCAGCCTGTGCTCGG + Intronic
1138292337 16:55858361-55858383 TTGCTTGGACAGCCTGTGCTTGG + Intronic
1139439892 16:66961156-66961178 CCTCTGGCTCAGCCTGAGCATGG + Intergenic
1139505300 16:67395497-67395519 CTGCTGGCCCGGCCTGGCCAGGG + Exonic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142406292 16:89892099-89892121 TTGCTTCCACAGCCCGTGCAGGG + Intronic
1142432288 16:90036120-90036142 CTGTTGGCACCCCCAGTGCAGGG + Intronic
1142640262 17:1281334-1281356 CTGCTGGCCCAGGCTGGTCAGGG + Intronic
1142804170 17:2362860-2362882 CTGCTGGCAGACCCTGTGTTCGG + Exonic
1142805722 17:2370129-2370151 CGGCTGGCTCAGCCTGGGCCGGG - Intronic
1143156544 17:4840914-4840936 TTGGTGGCACAGCCTGTGGGAGG + Intronic
1144088793 17:11834838-11834860 GTGCTGGCTCAGCCTTTGCCAGG - Exonic
1144579096 17:16447919-16447941 CTGCCGGCACAGCTTCTCCATGG + Exonic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1145250339 17:21293800-21293822 CAGATGGCACAGCCTGGGCCTGG + Intronic
1146657808 17:34645327-34645349 CTGCTTCCACAGCTTCTGCAAGG + Intergenic
1147371003 17:39993006-39993028 CTGCTGGCACTGCCACCGCAAGG + Intronic
1147609512 17:41793353-41793375 CAGCTGTGTCAGCCTGTGCATGG - Intergenic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1148238417 17:45984100-45984122 GTGCGGCCACAGCCTGAGCACGG - Intronic
1149850091 17:60028995-60029017 CTGGTGGCCCACCCTGTGCAGGG - Intergenic
1149860076 17:60117529-60117551 CTGGTGGCCCACCCTGTGCGGGG + Intergenic
1151788286 17:76287354-76287376 CTGATGGCCCAGGCTCTGCATGG - Intronic
1152008041 17:77694739-77694761 ATGCAGGACCAGCCTGTGCAGGG - Intergenic
1152097748 17:78281743-78281765 CTGCTGCCACAGCCTTGGCAGGG - Intergenic
1152369670 17:79878509-79878531 CTGCTGGTACAGCCATTTCATGG + Intergenic
1152441545 17:80312904-80312926 CTGCTGGCACAGGCTGCTCAAGG - Intronic
1152566186 17:81101385-81101407 CTGCTGGCCCTGCCTGTTCCCGG - Intronic
1153394323 18:4601109-4601131 CTGCTAGTACAGTCTGTGCGAGG + Intergenic
1155590398 18:27420920-27420942 ATCCTGTCACAGCCTGTTCAGGG + Intergenic
1155795573 18:30032461-30032483 ATGCTGACACAGGCTGTGTAGGG + Intergenic
1156476795 18:37410542-37410564 TGGCTGGCACAGCGTGTGCAGGG - Intronic
1157685643 18:49640533-49640555 CAGGTGGCACAGCCAGGGCAGGG - Intergenic
1157795485 18:50570596-50570618 CTGATGGTTCAGCCTCTGCAAGG - Intronic
1157908203 18:51588817-51588839 CTGGTGGCACGGGCTGTGCAAGG + Intergenic
1159671835 18:71229915-71229937 TTGCTGCCACAGCCTGAGTAGGG + Intergenic
1160117931 18:76099572-76099594 CTGCTCCCACAGCCTTAGCAAGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160534481 18:79584886-79584908 CTGCTGGCACTGGGTGTGCTGGG + Intergenic
1161128682 19:2574937-2574959 CTGCTGGCAGGCCCTGTGAAAGG + Intronic
1161719260 19:5894202-5894224 CTGCTGGACCAGCCTGTCCGGGG + Intronic
1162295564 19:9811097-9811119 CTGCAGGCACAGACTCTCCAGGG + Exonic
1162421793 19:10569605-10569627 CTGCTGGCTCAGTCTGAGCCCGG - Intergenic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163517610 19:17774530-17774552 CTTCTGGGATAGCCTGGGCAGGG - Intronic
1163527784 19:17831618-17831640 CAGCTGGCACGGCCTGGGCAGGG - Intronic
1163552404 19:17972957-17972979 CAGAGGGCACAGCCTGTGCAAGG + Intronic
1164443324 19:28296787-28296809 CTGCCAGCTAAGCCTGTGCATGG + Intergenic
1164706746 19:30325511-30325533 CTCCAGTGACAGCCTGTGCATGG + Intronic
1165633061 19:37317898-37317920 CTGCAGACCCAGCCTGTGCCGGG - Intronic
1166084413 19:40465610-40465632 CTGCTTGCACCGCCTGCGCCAGG + Exonic
1166140034 19:40800571-40800593 CGGCTGGCACGGGCTGTCCATGG - Exonic
1166423601 19:42656770-42656792 GTGCTGGCACAGGGTGTGAATGG - Intronic
1166749114 19:45156338-45156360 CTGCTGGCCCGGCCAGAGCATGG + Intronic
1167422401 19:49411996-49412018 GCACTAGCACAGCCTGTGCAAGG + Intronic
925020292 2:563119-563141 CTGCAGGCACAGCCAGTTCATGG + Intergenic
925409585 2:3632214-3632236 CTGATGGCAGAGGCTGTGCTCGG + Intronic
925430855 2:3791734-3791756 GTGCTGGCCCAGCCTTGGCATGG - Intronic
926000688 2:9329758-9329780 CTGGTGGCACAGCCTGCTCTGGG - Intronic
926913333 2:17871617-17871639 CTCCTGGCTGAGCCTGTGCCTGG + Intergenic
927865988 2:26588053-26588075 GTGGTAGCAGAGCCTGTGCAGGG - Intronic
930295479 2:49548071-49548093 CTGCTGCCTCAGGCAGTGCAGGG + Intergenic
931766256 2:65459164-65459186 CTGCTGGAAGAGACTGTGAAGGG - Intergenic
931997952 2:67857009-67857031 TTGCTAGCACAGGCTGTTCATGG + Intergenic
932015635 2:68023895-68023917 CTGCTGGCACAGACTCTCCAGGG + Intergenic
932024179 2:68116806-68116828 CTGCTGACACAGTCTCTGTAAGG - Intergenic
932385521 2:71329065-71329087 CTCCTGCCAAAGCCTGGGCACGG + Intronic
932467539 2:71933281-71933303 CTGTTGGCCCAGCCTGGGCTCGG - Intergenic
933621570 2:84548836-84548858 CTTCTGGCCCAGCCTGGGCATGG + Intronic
936075733 2:109400828-109400850 ATGCTCCCACAGCCTGTGCCTGG + Intronic
937127285 2:119482682-119482704 CTGCTGGCTGGGCCTGAGCAGGG + Intronic
938390467 2:130901254-130901276 CTGCTGACATAGCCTGAGCCTGG + Intronic
938483176 2:131679174-131679196 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
939789008 2:146548600-146548622 CTGCTGCCTCAGGCAGTGCAGGG + Intergenic
943793418 2:191961879-191961901 CTGCTGTCATAGCTTCTGCAAGG + Intronic
946419700 2:219557890-219557912 CTGCAGGCCCAGCCCATGCAGGG - Exonic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
947935467 2:233999888-233999910 CTGCTGCAACTGCCTGGGCATGG - Intronic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948426102 2:237887292-237887314 CTGCTGGCCCTGCCTGTGCCTGG - Intronic
948529584 2:238595817-238595839 CTGCTGACACATCAAGTGCATGG - Intergenic
948901466 2:240958725-240958747 CTGCTGCCGCAACCTGGGCAGGG + Intronic
948983646 2:241507749-241507771 CTGGTGGCTCCGCCTGTGCGAGG - Intronic
1169207875 20:3750116-3750138 CTGCTGGCCCACACCGTGCAGGG + Exonic
1169349803 20:4858968-4858990 CCTTTGGCACAGGCTGTGCAGGG + Intronic
1170610158 20:17906297-17906319 CTTTTGGCACACCTTGTGCAGGG - Intergenic
1171185300 20:23120435-23120457 CTGCTGCCACAGCCTAGGCAAGG - Intergenic
1172273578 20:33667891-33667913 CTGCTGGGCCAGGCTGAGCAGGG + Exonic
1173022848 20:39282647-39282669 CTGCTTGCACAGGCTGTCGAGGG + Intergenic
1173074836 20:39807840-39807862 TTTCTGGCATAGCATGTGCAGGG + Intergenic
1173451919 20:43172377-43172399 CTTGCTGCACAGCCTGTGCAAGG - Intronic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1173972553 20:47163974-47163996 CTGCTGGCAGAGACGGTGGAAGG - Intronic
1174160366 20:48546165-48546187 CAGCTGGCAGAGCGGGTGCATGG + Intergenic
1175745262 20:61452088-61452110 ACGCTGGCTCAGCCTGTGCTTGG + Intronic
1175811739 20:61862039-61862061 CTGAGGGCACAGCCTTTGCCAGG - Intronic
1175892744 20:62322693-62322715 CAGCGGGCACTGCCTGTGCAAGG - Exonic
1175986866 20:62768382-62768404 CTGCTGCCCCAGCCCCTGCAAGG + Intergenic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1179175459 21:39005013-39005035 CTGCTGGCAAGGCCTCTGTAGGG - Intergenic
1179524065 21:41964315-41964337 CTCCTGGGACAGCTTCTGCAGGG - Intergenic
1180484254 22:15781637-15781659 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1180841482 22:18960864-18960886 CTGCTGGCGCGCCCTGAGCAGGG + Intergenic
1180948410 22:19709328-19709350 CTGCCGGGACAGCCTGGGGATGG + Intergenic
1181038561 22:20181471-20181493 CGGCTGGCCCAGCCTGCCCAGGG + Intergenic
1181172608 22:21018152-21018174 CTGAAGGCTCAGCCTGTGCTCGG + Intronic
1181670657 22:24424176-24424198 CTGCCGGCACTGCCTGTGAAGGG + Intronic
1182123296 22:27800275-27800297 CTGCAAGCGCAGCCTGTGCACGG - Exonic
1182150401 22:28023370-28023392 CAGCAGGAAAAGCCTGTGCAAGG - Intronic
1183259969 22:36788338-36788360 CTTCTGCCTCGGCCTGTGCAGGG + Intergenic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1184388341 22:44188810-44188832 CTGCAGGCACAGGCTGATCAAGG + Intronic
1184494273 22:44828396-44828418 CTGCTGGCTGAGCCTGGTCAAGG - Intronic
1185330537 22:50250275-50250297 CTGCTGGCACTGCCAGAGCCTGG - Intronic
949095632 3:82041-82063 CATCTGGTACAACCTGTGCATGG - Intergenic
950342307 3:12258190-12258212 CTGCAAGCACAGCCTGTGTGAGG - Intergenic
950612458 3:14135028-14135050 GTGACGGCACAGCCTGGGCACGG + Intronic
950959914 3:17094606-17094628 TAGCTGGCACAGCCACTGCAGGG + Intergenic
953114849 3:39982283-39982305 TTGCTGACACAGACTGTGAAAGG - Intronic
953605278 3:44409723-44409745 CTGCCAGGACAGCCTGGGCAGGG - Intergenic
954396686 3:50296877-50296899 CAGCTGGGTGAGCCTGTGCAGGG - Exonic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
955351728 3:58198376-58198398 CTGCTGGCACACCTTGTTCTGGG + Intronic
958799220 3:98736495-98736517 CTGCTTCCACAACCTGTGGAAGG - Intronic
959166854 3:102791141-102791163 CTGCTGGCAGGGAATGTGCAAGG + Intergenic
960044115 3:113179705-113179727 CTCCTGTTGCAGCCTGTGCAGGG - Intergenic
960997556 3:123349993-123350015 CTGCTGGGACAGCAGGTGGAAGG - Intronic
961151401 3:124641461-124641483 CTGCTGGCAGTGACTGTGTAAGG + Intronic
961212682 3:125137979-125138001 CTGCTGGCCCAGCCTGCTCTGGG + Intronic
961391747 3:126556242-126556264 CTGCTGTCACTCTCTGTGCATGG - Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
963884864 3:150570770-150570792 CTGCTGACAGAGGCTGGGCACGG + Intronic
964726433 3:159818696-159818718 TTGCTGGAGCAGCCTGTCCAAGG + Intronic
968495361 4:912310-912332 ATGCTGGGACAGCCTGAGAAGGG + Intronic
972090241 4:35272497-35272519 CTGCTGACAAAGCAAGTGCAAGG + Intergenic
976928649 4:90534417-90534439 AGGCTGGCACAGCCTGGGCTCGG - Intronic
981408851 4:144404089-144404111 TTCCTGGCAAAGTCTGTGCAAGG - Intergenic
982159026 4:152548665-152548687 ATGGTGGCAGAGCCTGAGCAGGG - Intergenic
983581914 4:169317740-169317762 CTGCTGCCTCAGGCAGTGCAGGG - Intergenic
985362547 4:189191159-189191181 CTGCTAATACAGCCTGTGGAAGG + Intergenic
985680755 5:1254435-1254457 TTGGTGGCACAGCCACTGCACGG + Exonic
985811558 5:2093968-2093990 CTGCTGGAACACAGTGTGCATGG - Intergenic
985856162 5:2429109-2429131 CAGCTGGCAGGGCCAGTGCACGG - Intergenic
986132661 5:4945086-4945108 GTGCTGGCAAAGCCTCTGGAGGG - Intergenic
986723607 5:10577989-10578011 AAGCTGGCACAGCCTGTGAGGGG + Intronic
987677364 5:21091602-21091624 CTGCTGCCTCAGCCTTTCCAAGG + Intergenic
988852679 5:35195114-35195136 GAGCTGCCACAGCCTGTGCCAGG - Intronic
989121562 5:38009586-38009608 ATGCTGGCAAAGCCCATGCATGG - Intergenic
990537587 5:56738045-56738067 CCACTGGCAGAGCCGGTGCAGGG - Intergenic
996506931 5:124277919-124277941 CTCCTGGCACAGGCTGTGATGGG + Intergenic
996714843 5:126578969-126578991 GTGCTGGCACAGCCTCTTCCTGG + Intronic
997351136 5:133232305-133232327 GTGGTGGCCCCGCCTGTGCATGG + Intronic
997446638 5:133945115-133945137 CTCCTGGCACAGCCAGAGGAGGG - Intergenic
998879020 5:146628440-146628462 TTGCTGGTAGAGCCAGTGCAAGG + Intronic
999212068 5:149898255-149898277 ATGAGGGCACAGCCTGGGCATGG - Intronic
1000176192 5:158757030-158757052 CTCCTGGCTCAGCCTGTGAAGGG - Intronic
1002711163 5:181195719-181195741 CCCCTGGCACAGTCTTTGCAGGG + Intronic
1003473644 6:6461450-6461472 CTGCTGGCATCGCCTCTGCTGGG - Intergenic
1006795787 6:36731605-36731627 CTGCTGGCATACCTTGTCCATGG + Intronic
1007486573 6:42184688-42184710 TTCCTGGCACCCCCTGTGCAGGG - Exonic
1008147345 6:47907753-47907775 CTGCTGGCAAAGGTTGAGCAGGG + Intronic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1013402199 6:109809627-109809649 CTGCTGGCAAATACTGAGCAAGG - Intronic
1016831770 6:148441308-148441330 CTGCTGGCACAGGCGGTTCTGGG + Intronic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1018431866 6:163729167-163729189 CTGGCGGCACGGCGTGTGCAGGG + Intergenic
1019188817 6:170238252-170238274 CTCCTGGCGGAGCCTGTCCAGGG + Intergenic
1019261055 7:82242-82264 CTGTGTGCACAGCCTGTGCCTGG + Intergenic
1019303036 7:318562-318584 CTGCTGCCCAAGCCTGTGAATGG - Intergenic
1019480705 7:1265393-1265415 CGGCAGGGACAGACTGTGCAGGG + Intergenic
1019541907 7:1555391-1555413 CAGCTGGCACAGCCGGTGGGGGG + Exonic
1019568628 7:1697366-1697388 CTGCTGGAGGGGCCTGTGCAGGG + Intronic
1019584185 7:1787831-1787853 ATGCTGGTACTGCCGGTGCATGG + Intergenic
1019873977 7:3792463-3792485 CTGCTGGGTCTGCCTGGGCAGGG - Intronic
1021839324 7:24709708-24709730 CTGCAGGCACATCCTGGGCATGG + Intronic
1022472020 7:30687877-30687899 ATGCTGGCATGGCCTGTGCTAGG + Intronic
1022506997 7:30913646-30913668 CAGCTGGCTCAGCCTGGCCATGG + Intronic
1022537408 7:31106712-31106734 CTGCGGTCCCAGCCTGTGGATGG - Exonic
1023197935 7:37662953-37662975 CAGCTGGCACATCAAGTGCAGGG - Intergenic
1023932260 7:44713078-44713100 CTCCTGGCACAGCCCCAGCAGGG - Intergenic
1023958600 7:44908103-44908125 CCCATGGCACAGCGTGTGCAGGG - Intergenic
1026915976 7:74120699-74120721 CTGCAGGCTCAGCATCTGCAGGG + Intronic
1028659516 7:93253532-93253554 CTGCTGCCACGGCCTGTGACAGG - Intronic
1030301148 7:107976275-107976297 CTGCTAGGAAAGCCTGTCCACGG + Intronic
1032268804 7:130385776-130385798 CTCCTGGAACAGCATGTCCAGGG - Intronic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1034224934 7:149474850-149474872 CTGCCGCCACCGCCTGTGCCCGG + Exonic
1035147268 7:156831666-156831688 CAGCTGGCACAGCACGTGCGAGG - Intronic
1035566239 8:643280-643302 CTGCGAGCACAGCCTGCGCCTGG - Intronic
1035618299 8:1018551-1018573 CTCCTGGCTCTGCCTGTGCTGGG + Intergenic
1037014206 8:13882173-13882195 CTGCTGGCACAGTGAGTTCAGGG + Intergenic
1039873593 8:41567330-41567352 CTGCGGGCACAGCCTGAAGAGGG + Intergenic
1041113226 8:54507167-54507189 TTTCTGGCACAGCCAGTGAATGG - Intergenic
1042409207 8:68443059-68443081 CTGCTTCCACAGCCTGTGGTTGG + Intronic
1042874370 8:73427259-73427281 CTGCCGGCACAACCTCTCCAAGG - Intronic
1044466250 8:92509843-92509865 ATGCTGGCACTTCCTCTGCAAGG + Intergenic
1047029175 8:120857894-120857916 CTGCTGGTACAGGCTGGGCCTGG - Intergenic
1047101070 8:121676395-121676417 ATGGTGGCACTGCCTCTGCAGGG - Intergenic
1047204728 8:122793913-122793935 CTGCTGGCACACCCTGAGTGTGG + Intronic
1047296187 8:123572536-123572558 CTGCTGGCACAGGCTATGGAGGG + Intergenic
1047894632 8:129352968-129352990 CTGCAGGCACAATCTGTTCAGGG + Intergenic
1048261585 8:132949855-132949877 CTGCTGGGAGAGGCAGTGCAGGG - Intronic
1049254089 8:141604784-141604806 TTGCTGGCCCAGCCTGACCATGG + Intergenic
1049271128 8:141696863-141696885 TAGGAGGCACAGCCTGTGCAGGG + Intergenic
1049357412 8:142195640-142195662 CAGCTGGCACAGCATCTGCAGGG + Intergenic
1049499115 8:142952074-142952096 CTGCTGGCCCAGCCTGGAAAAGG - Intergenic
1049594587 8:143477534-143477556 CTGCAGGCCCAGCAGGTGCATGG + Intronic
1049610724 8:143553589-143553611 CTTCTGGCCCCGCCTGTGAATGG + Exonic
1049806909 8:144545220-144545242 CTGGTGGCAAAGCCCGTGCATGG + Intronic
1057132066 9:92661238-92661260 CTGCTGGCCCAGCCTCAGCCTGG + Intronic
1057442347 9:95091462-95091484 CTGCAGGCTCACTCTGTGCAGGG + Intergenic
1057748720 9:97772819-97772841 CTGCTGCCAGGGCCTGTGCTTGG - Intergenic
1057807391 9:98229335-98229357 ATGCTGACACAGCTTGTCCAGGG + Intronic
1060931513 9:127492188-127492210 CTGATGGCACAGGCTGGGCCTGG - Intronic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061239130 9:129358980-129359002 CAGCAGGGACAGCATGTGCAAGG - Intergenic
1061502042 9:131009517-131009539 CTGGTGGCAGAGCCCGTCCATGG + Exonic
1061824165 9:133247470-133247492 CTGCTGGCAGAGCTTGTCCCTGG - Intergenic
1062027103 9:134345609-134345631 CTGGTGGGACAGCCTCTGCCGGG - Intronic
1062178851 9:135179868-135179890 CTGGTGGCATGGCCTGAGCAGGG + Intergenic
1062252603 9:135605759-135605781 CTGATGGCATAGGCTGGGCATGG + Intergenic
1062320026 9:135986320-135986342 CTGCTGGCACTGGCTGTGGCAGG - Intergenic
1062425221 9:136503142-136503164 CTGCAGGCAGAGCCTGTTCCCGG + Intronic
1062521089 9:136958284-136958306 CCGCTGGCAAAGGCTGTGCCAGG - Intergenic
1062575468 9:137205299-137205321 CTGCTGGCACTGCGTGTGGATGG - Exonic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1192051903 X:67732231-67732253 CTGAAGGCACAGACAGTGCATGG - Intergenic
1192081401 X:68051336-68051358 GTGCTGGTACAGACTGTCCAAGG - Intronic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1200283838 X:154802116-154802138 CAGAGGGAACAGCCTGTGCACGG - Intronic
1200973377 Y:9180083-9180105 CTGTTGTCTCAGCCAGTGCAGGG + Intergenic
1200988271 Y:9326005-9326027 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202119750 Y:21510188-21510210 CTGCAGGCACAGCCTGGCCCTGG - Intergenic
1202122203 Y:21533729-21533751 CTGCAGGCACAGCCTGGCCCTGG - Intronic
1202156804 Y:21895654-21895676 CTGCAGGCACAGCCTGGCCCTGG + Intronic
1202159250 Y:21919195-21919217 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202185699 Y:22184110-22184132 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202205661 Y:22402286-22402308 CTGCAGGCACAGCCTGGCCCTGG - Intronic