ID: 954965107

View in Genome Browser
Species Human (GRCh38)
Location 3:54603410-54603432
Sequence CCCCTAAGGATACCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954965107 Original CRISPR CCCCTAAGGATACCCCAGAG GGG (reversed) Intronic
902173287 1:14630200-14630222 TCCCTAGGGATACCCCAGCTCGG + Intronic
903539632 1:24089755-24089777 CCCCTACCCATCCCCCAGAGAGG + Intronic
904577901 1:31517315-31517337 CACCTAAGAACACCCCAGTGGGG - Intergenic
906644209 1:47461940-47461962 GCTCTAAGCACACCCCAGAGAGG + Intergenic
917612781 1:176705803-176705825 GCCCTAAGGATTCCCTAGACAGG + Intronic
918044700 1:180934971-180934993 CCCACAAGGTTACTCCAGAGAGG - Intronic
918534759 1:185561583-185561605 CCAGTAGGGGTACCCCAGAGGGG - Intergenic
922225698 1:223644501-223644523 ACCCTAAGGATACAACAGTGGGG + Intronic
922817797 1:228463357-228463379 CCCCTAAAAATACCCCATACCGG - Intergenic
1063539276 10:6915844-6915866 CCCATCAGGATATCCCAGAATGG + Intergenic
1070712627 10:78693856-78693878 CCCAGAGGGATACCTCAGAGTGG - Intergenic
1071592336 10:86886636-86886658 CCCCTAGGGAGAGCACAGAGAGG + Intronic
1072904715 10:99442212-99442234 CCCATCAGGATCCCCCAGAAGGG + Intergenic
1072944387 10:99796788-99796810 CCCCCAAGGAGATGCCAGAGTGG + Intronic
1077434697 11:2533219-2533241 CTGCTAAGGAAACCCCAGCGCGG + Intronic
1078533040 11:12151707-12151729 CCCATAAGAATCCCCCATAGTGG - Intronic
1079348390 11:19672527-19672549 CTCCTGAGGATACCCCCAAGAGG - Intronic
1082788459 11:57330643-57330665 CCCCTCAGGAGCCCCCAGTGGGG - Intronic
1084462533 11:69303891-69303913 CCCATAAGAATACACTAGAGCGG - Intronic
1085766949 11:79291561-79291583 CTCCTATGGAAATCCCAGAGAGG + Intronic
1090419915 11:126567620-126567642 CTGCTAAGGAGACCCCAGGGTGG + Intronic
1091443161 12:527341-527363 CCCCTAAGGGGGCCCAAGAGAGG - Intronic
1093180850 12:15965644-15965666 TCACTAAGGAGAACCCAGAGAGG - Intronic
1095134445 12:38582658-38582680 CCCCTCACCATACCCCCGAGAGG + Intergenic
1096843473 12:54392547-54392569 CCCTTAAGAATACCTCTGAGTGG - Intergenic
1097144376 12:56929897-56929919 CCTCTAAGGACCTCCCAGAGGGG + Intronic
1102700481 12:114834879-114834901 CCCCCATGGAGACCCCAGAAGGG - Intergenic
1103181336 12:118914555-118914577 CCCAAAAGTCTACCCCAGAGTGG - Intergenic
1104943218 12:132404484-132404506 CCCCTCAGGATCCACCAGGGAGG - Intergenic
1109147163 13:58793234-58793256 CCGCTATGGATACCCTAGTGGGG + Intergenic
1110187210 13:72689190-72689212 CACCTGTGGATACCACAGAGAGG + Intergenic
1118114530 14:62760416-62760438 CCCCTAATGATAGCACACAGAGG - Intronic
1121570521 14:94943339-94943361 CCCCTCATGATAGCCCCGAGGGG - Intergenic
1122115518 14:99525490-99525512 CCCCTAAGCACAGCCCAGAAAGG - Intronic
1123027966 14:105437507-105437529 CCCCTGAGGACACGCCAGTGAGG - Intronic
1202898238 14_GL000194v1_random:22137-22159 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1124689726 15:31811950-31811972 CCCCTGAGGAGACCTGAGAGAGG + Intronic
1126471721 15:49019550-49019572 AACCTAAGTAAACCCCAGAGGGG + Exonic
1128332151 15:66762964-66762986 CCCCAAAGGACACAGCAGAGAGG + Intronic
1133274137 16:4626320-4626342 CCTCTAGGGAAACCCCAGGGTGG - Intronic
1135539300 16:23317639-23317661 TCCCAAAGGGTTCCCCAGAGCGG + Intronic
1141552200 16:84813544-84813566 CACCTCAGGGTCCCCCAGAGAGG + Intergenic
1141616219 16:85211173-85211195 GCCCTAAGGAACTCCCAGAGGGG - Intergenic
1141852836 16:86659062-86659084 CCCAGAAGGATAGCCCAGGGTGG - Intergenic
1144241397 17:13315960-13315982 CCCACAAGGATACAGCAGAGGGG - Intergenic
1146724652 17:35147618-35147640 CCCACCAGGATAACCCAGAGTGG + Intergenic
1148823537 17:50375645-50375667 CCCTCCATGATACCCCAGAGAGG + Exonic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152630251 17:81407717-81407739 CCAGTAAGGATATCCCAGCGGGG + Intronic
1203162135 17_GL000205v2_random:62715-62737 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1203162418 17_GL000205v2_random:63803-63825 CCACTAGGGATACCTCAAAGTGG - Intergenic
1203162526 17_GL000205v2_random:64230-64252 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1203162583 17_GL000205v2_random:64453-64475 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1157568371 18:48695978-48696000 CCTCCTAGGATACCTCAGAGTGG - Intronic
1160343214 18:78107612-78107634 GCCCTTAGAATACCCCAGAGGGG - Intergenic
1161885312 19:6990166-6990188 CCCTTTAGCCTACCCCAGAGAGG + Intergenic
1163614921 19:18321310-18321332 CCTCTAAGTACACCGCAGAGAGG + Intronic
1165334161 19:35157331-35157353 CCCCTAAGGTTTCACCAGGGAGG + Intronic
1167664628 19:50817051-50817073 CCCCCAAGGTCACCCCACAGAGG - Intergenic
926691738 2:15740048-15740070 CTCCCAAGTATACCCTAGAGTGG + Intronic
929279226 2:40060127-40060149 TCCATGAGGATACCACAGAGAGG - Intergenic
938490047 2:131756539-131756561 CCGCTAGGGGTACCCCAAAGCGG + Intronic
943821398 2:192327206-192327228 CCCCTTAGGATTACCCTGAGGGG - Intergenic
945078340 2:206063191-206063213 CCCCCAAGGATACCACAGTTTGG + Exonic
946597063 2:221317518-221317540 CTCCTATGGTTACCCCAGAGGGG - Intergenic
948963372 2:241356783-241356805 CCCGGAAGGACACCCCAGAGTGG + Intronic
1169775549 20:9248941-9248963 CCCCTCAGGAGCCCCCAGAAAGG - Intronic
1170429279 20:16261661-16261683 GCCCTTAGGATATCACAGAGGGG + Intergenic
1174693535 20:52533676-52533698 TCCTTAAGGAGACACCAGAGAGG + Intergenic
1176094104 20:63331867-63331889 CACCAAAGCATACCCCAAAGAGG + Intronic
1176617923 21:9038128-9038150 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1176618393 21:9039949-9039971 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1179040305 21:37796735-37796757 ACTCAAAGGAGACCCCAGAGAGG - Intronic
1180291155 22:10852213-10852235 CCGCTAGGGGTACCCCAAAGCGG + Intergenic
1180493960 22:15881635-15881657 CCGCTAGGGGTACCCCAAAGCGG + Intergenic
1183334553 22:37239160-37239182 CCCCAGACGAGACCCCAGAGCGG - Intronic
950263424 3:11558552-11558574 CCCTTCAGGAGACCACAGAGGGG + Exonic
952943716 3:38461638-38461660 CCCCCAACTATACCCCAGGGTGG - Intronic
954965107 3:54603410-54603432 CCCCTAAGGATACCCCAGAGGGG - Intronic
955754627 3:62215156-62215178 GCCCTCAGGATACCCCTGAGTGG - Intronic
959823674 3:110767587-110767609 CCCTCAAGGATACCTTAGAGAGG - Intergenic
961325035 3:126104724-126104746 CCCCCAAGGGTACCCATGAGAGG - Intronic
961648806 3:128407371-128407393 CCCATCAGGACACCCCAGTGGGG - Intronic
965064573 3:163829787-163829809 CCCATAAGGGTACCCCAGAAAGG - Intergenic
969444126 4:7234497-7234519 CGCCCAGTGATACCCCAGAGAGG - Intronic
973386798 4:49518696-49518718 CCACTAGGGATACCCCAACGCGG - Intergenic
989513285 5:42313353-42313375 CCTCTGAGGATACACCAGAATGG + Intergenic
995103095 5:108339788-108339810 CCGATAAGGATATCCCAGTGTGG - Intronic
995268965 5:110199391-110199413 CCTCTAAGGAAAACACAGAGAGG + Intergenic
996871704 5:128199681-128199703 CCCCTAAGGAGCTCCCAGATTGG - Intergenic
1004273152 6:14212450-14212472 CCCTTAACAACACCCCAGAGAGG - Intergenic
1008072588 6:47112932-47112954 CCCCTGAAGATGCCCCAGCGGGG + Intergenic
1014799880 6:125766904-125766926 ACCCCAAGGATTCCCAAGAGTGG + Intergenic
1021253631 7:18362031-18362053 CTCCTAAGGAGTCACCAGAGGGG + Intronic
1031294487 7:119984111-119984133 CCCCTAAGGACATCAAAGAGGGG + Intergenic
1035076149 7:156178967-156178989 GCCCTGAGGTTACCACAGAGGGG + Intergenic
1038480417 8:27897940-27897962 CCTCTTAGGATTCCCAAGAGGGG + Intronic
1043700204 8:83277320-83277342 CCCCTGAGTATACCCTGGAGTGG + Intergenic
1047775619 8:128067818-128067840 CCCTGAGGGATGCCCCAGAGGGG + Intergenic
1049661071 8:143819998-143820020 CCCCTCAGGATCCCCGAGATGGG + Intronic
1053392476 9:37745751-37745773 CCCCTAGGGACAGCCCTGAGTGG + Exonic
1053761577 9:41352573-41352595 CCACTAGGGGTACCCCAAAGCGG - Intergenic
1054540171 9:66263689-66263711 CCACTAGGGGTACCCCAAAGCGG - Intergenic
1193234117 X:79085563-79085585 CCCCTAGGAATACCAAAGAGAGG + Intergenic
1195992517 X:110696741-110696763 TACATAAGGATACCTCAGAGCGG - Intronic
1197711899 X:129677794-129677816 CCCCTAGAGATAGCCTAGAGGGG + Intergenic
1199084979 X:143617900-143617922 CCACTAAGGAGACACCAGACGGG + Intergenic
1199274191 X:145922793-145922815 CACCTATGGCTACCCCACAGTGG - Intergenic
1200905038 Y:8473209-8473231 GCCCTAAGGATAACACTGAGAGG - Intergenic
1201151305 Y:11096966-11096988 CCGCTAGGGGTACCCCAAAGCGG - Intergenic
1201151779 Y:11098791-11098813 CCGCTAGGGGTACCCCAAAGCGG - Intergenic