ID: 954967715

View in Genome Browser
Species Human (GRCh38)
Location 3:54625869-54625891
Sequence TAGGACCCCCAAAATGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954967715_954967719 10 Left 954967715 3:54625869-54625891 CCGTGATCATTTTGGGGGTCCTA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 954967719 3:54625902-54625924 CCAATTAGACACATCATGAATGG 0: 1
1: 0
2: 0
3: 11
4: 123
954967715_954967720 11 Left 954967715 3:54625869-54625891 CCGTGATCATTTTGGGGGTCCTA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 954967720 3:54625903-54625925 CAATTAGACACATCATGAATGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954967715 Original CRISPR TAGGACCCCCAAAATGATCA CGG (reversed) Intronic
901926694 1:12570748-12570770 TAGGAGCCCCTAGTTGATCAGGG - Intronic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
923493480 1:234505020-234505042 TTGGACCCCCAAAATCACTAAGG - Intergenic
1081399611 11:42627443-42627465 TAGGTCCCCAAAGATGTTCATGG + Intergenic
1085273194 11:75282392-75282414 TAGGCCCACCAAAATCATCCAGG - Intronic
1085360569 11:75881565-75881587 TTGGGCCCCCAAAATCATTAAGG - Intronic
1086400779 11:86459592-86459614 TAGTACCACCAGAATGGTCAGGG - Intronic
1088628738 11:111753343-111753365 TAGAACCCCCAAAAAGAAAATGG - Intronic
1088951866 11:114579796-114579818 TAGAACCAGCAAAATGATTAAGG - Intronic
1091169313 11:133506379-133506401 AAGCACCTCCAAAATGCTCAGGG + Intronic
1091435349 12:468345-468367 AAAGACCCCCAAAAAGGTCAGGG - Intronic
1095773403 12:45987270-45987292 AAGGACCCCTGAAATGAACATGG + Intronic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1098864563 12:75747119-75747141 TTGGGCCCCCAAAATGACTAAGG - Intergenic
1102602468 12:114042402-114042424 TAGGGCTCCCAGAATGAACAAGG - Intergenic
1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG + Intronic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1107818239 13:44263449-44263471 TAGCACCCCCAAAATGATTCTGG - Intergenic
1112727613 13:102322416-102322438 TAGGATCCCCAAAAGCCTCAGGG - Intronic
1114684376 14:24514168-24514190 GAAGACCAGCAAAATGATCAGGG + Intergenic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG + Intergenic
1129770253 15:78198855-78198877 TAGCAAACCCAAAATGCTCATGG + Intronic
1137518279 16:49169522-49169544 GAGGACATCGAAAATGATCAAGG + Intergenic
1139231172 16:65283828-65283850 TAGGGCCCCCAAAAAGATCTTGG - Intergenic
1141158577 16:81613646-81613668 TAAGACTCTAAAAATGATCATGG - Intronic
1147242139 17:39097363-39097385 TAGTAAACCCCAAATGATCATGG - Intronic
1148378921 17:47177663-47177685 TAGGACCCTCAAAATAACCTAGG + Intronic
1149165958 17:53752272-53752294 TCTAACCCCCAAAATGTTCAAGG + Intergenic
1151266977 17:72964029-72964051 TAGGACCCCCAAAAGTACAAAGG + Intronic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1157887197 18:51380281-51380303 CATGAGCCTCAAAATGATCAGGG - Intergenic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1158135123 18:54199544-54199566 TTGGACTTCCAAAATGATCTTGG - Intronic
1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG + Intronic
1161888663 19:7017758-7017780 CCGGACCCCCAAGATGTTCAAGG - Intergenic
1166423074 19:42653336-42653358 GAGGACACCCAAGATGGTCAGGG + Intronic
928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG + Intronic
929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG + Intronic
934547311 2:95228802-95228824 TTGGGCCCCCAAAATCATTAAGG + Intronic
939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG + Intronic
945764027 2:213950867-213950889 AAGGTCCCCCAAAATTAGCAGGG - Intronic
946592659 2:221268267-221268289 TAAGACCCTGAAAATGATCCTGG + Intergenic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1170950037 20:20928113-20928135 TAGGTCCCCCAAAATGCTTGTGG + Intergenic
1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG + Intergenic
1177350749 21:19938271-19938293 TTGGACCCCCAAAATTATACTGG - Intergenic
1181562752 22:23715224-23715246 TAGGCCCCCCAAAGGGATCCAGG + Intergenic
950792058 3:15479847-15479869 TAGTACCCACAAATTGACCATGG - Intronic
951154137 3:19328408-19328430 AAAGACCCCCAAATTCATCATGG - Intronic
953352894 3:42229526-42229548 TTGGAGCCCCAAACTCATCAGGG - Intergenic
953579640 3:44142166-44142188 AATGCCCCCCAAAGTGATCAAGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG + Intronic
963764942 3:149324779-149324801 ATGGAACCCCAAAGTGATCATGG + Intronic
964302202 3:155301038-155301060 GATGACCCTCAAAATGATCTTGG - Intergenic
965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG + Intergenic
965109706 3:164405004-164405026 AAGGACCTGCAATATGATCAGGG - Intergenic
971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG + Intergenic
973107256 4:46355672-46355694 CAGGAACCCCCAAATAATCAGGG + Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
978613302 4:110567984-110568006 TAATACTCCCAAAATTATCAAGG - Intergenic
981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG + Intergenic
981945567 4:150339616-150339638 TATGGACCCCAAAATGTTCATGG - Intronic
983633704 4:169876541-169876563 GAGGCCCACCAAAATTATCAAGG + Intergenic
986502184 5:8412587-8412609 TTGGACCCCCAAAATCACTAAGG + Intergenic
988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG + Intergenic
995927616 5:117394328-117394350 AAGGACTCCCAAAGTTATCAGGG - Intergenic
996563467 5:124855646-124855668 TAGGACCTCCACATTGACCATGG - Intergenic
997408676 5:133673214-133673236 TTGGGCCCCCAAAATCATTAAGG - Intergenic
997670424 5:135666807-135666829 TTGGCCCTCCAAAATGAGCAAGG - Intergenic
999818829 5:155203946-155203968 ATGGACCCCAAAAGTGATCAGGG + Intergenic
1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG + Intergenic
1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG + Exonic
1019095206 6:169574210-169574232 GAGGACCCTCAAAATGAGTAAGG - Intronic
1024946862 7:54817166-54817188 TCGGACCCCCAAAATCACTAAGG + Intergenic
1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG + Intergenic
1031475719 7:122218707-122218729 TGGGACCCACAAAATTATCTGGG - Intergenic
1032678171 7:134152012-134152034 TAAGACCTCCAAAATAATGATGG - Intronic
1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG + Intronic
1041364482 8:57086875-57086897 TTGGGCCCCCAAAATTATTAAGG - Intergenic
1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG + Intergenic
1056702405 9:88921797-88921819 TTGAACCCCCAAAGTGACCACGG + Intergenic
1059375556 9:113878158-113878180 CAAACCCCCCAAAATGATCAAGG - Intronic
1061358071 9:130121456-130121478 TGGGACCCCCAAAACCAACAAGG + Intronic
1061905521 9:133694708-133694730 TAGGAGCCCCAGAATGAACGGGG - Intronic
1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG + Intergenic
1189451590 X:41137340-41137362 TAGAATGCCTAAAATGATCACGG - Intronic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1201376047 Y:13320972-13320994 TAGGAGCCCCAATATTATCTTGG + Intronic