ID: 954967719

View in Genome Browser
Species Human (GRCh38)
Location 3:54625902-54625924
Sequence CCAATTAGACACATCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954967710_954967719 21 Left 954967710 3:54625858-54625880 CCATTTTGATTCCGTGATCATTT 0: 1
1: 0
2: 0
3: 33
4: 252
Right 954967719 3:54625902-54625924 CCAATTAGACACATCATGAATGG 0: 1
1: 0
2: 0
3: 11
4: 123
954967717_954967719 -9 Left 954967717 3:54625888-54625910 CCTAAGCAGTGTGGCCAATTAGA 0: 1
1: 0
2: 0
3: 11
4: 96
Right 954967719 3:54625902-54625924 CCAATTAGACACATCATGAATGG 0: 1
1: 0
2: 0
3: 11
4: 123
954967715_954967719 10 Left 954967715 3:54625869-54625891 CCGTGATCATTTTGGGGGTCCTA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 954967719 3:54625902-54625924 CCAATTAGACACATCATGAATGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954967719 Original CRISPR CCAATTAGACACATCATGAA TGG Intronic
901148694 1:7085951-7085973 CAAACAAGACACATCAGGAAGGG - Intronic
907224192 1:52929083-52929105 CCAGATAGGCACATCATTAATGG - Intronic
910376251 1:86575136-86575158 CGAAGTGTACACATCATGAATGG + Intronic
919859134 1:201727514-201727536 CCAATTAGCCAAGTCATGATGGG - Intronic
923535529 1:234848234-234848256 ACAATTAGATTGATCATGAAAGG - Intergenic
1064551360 10:16503995-16504017 CCCATTAGACATTGCATGAAAGG - Intronic
1064551368 10:16504058-16504080 CCCATTAGACATTTCATGAAGGG - Intronic
1064612297 10:17115950-17115972 CCAATTGGACAGATGATGAATGG - Intronic
1072124394 10:92432670-92432692 ACAATTAGACACTTAATAAATGG - Intergenic
1073965727 10:108987458-108987480 CCTATTAGCCCCATAATGAAAGG + Intergenic
1074122494 10:110503306-110503328 CCAATAAGACACACCTTGACAGG - Intronic
1076201684 10:128563947-128563969 CCCAGTAAACACATCATAAATGG + Intergenic
1076594069 10:131614189-131614211 CCAATTAAAAACATAGTGAAAGG - Intergenic
1078606473 11:12780994-12781016 TAAATTAGACATATCATCAATGG + Intronic
1085918727 11:80925255-80925277 TGAATTAGACACATCTTTAAAGG + Intergenic
1088263925 11:107971735-107971757 ACAATTAGACAATTCATCAAAGG - Intergenic
1089066181 11:115663832-115663854 CCATTAAGACAACTCATGAAGGG - Intergenic
1089814556 11:121160796-121160818 ACAATTAGACCCAGCATTAAGGG - Intronic
1092122079 12:6051572-6051594 CCAGTTAGAAACATCCTGATTGG - Intronic
1093962428 12:25289341-25289363 TCGAACAGACACATCATGAAAGG + Intergenic
1094123673 12:27000117-27000139 CCATTTAGAGCCCTCATGAATGG - Intronic
1100090427 12:90961993-90962015 CCACATAGAGACATCATCAAAGG + Intergenic
1103576385 12:121880546-121880568 CCCATTAGAAACAGCATGGATGG + Intergenic
1106978218 13:35247400-35247422 CCAGTGAGACACATTAGGAATGG + Intronic
1109445353 13:62430921-62430943 CCAATTACATAAATCATTAATGG + Intergenic
1111327050 13:86712224-86712246 CCAATTTAACTCTTCATGAATGG + Intergenic
1112681493 13:101771300-101771322 CTAATGAGACACATGATGAAAGG + Intronic
1113682961 13:112257132-112257154 CCATTTACATACATCATGAATGG - Intergenic
1114333394 14:21660838-21660860 GAAATTAGAAACATCATAAATGG + Intergenic
1115327268 14:32154113-32154135 ACAATTTGTCACATCAGGAAAGG + Intronic
1116937457 14:50756764-50756786 CAATTCAGACACATCAAGAAAGG - Exonic
1119363293 14:74069797-74069819 CAAATGAGAAAAATCATGAAAGG - Intronic
1122489474 14:102104128-102104150 CCAATGATACTGATCATGAATGG + Intronic
1124235090 15:27983514-27983536 CCCACTATACACATCGTGAAAGG + Intronic
1125868945 15:43080016-43080038 TCAAATAGACACCTCAAGAAGGG - Intronic
1128127235 15:65202108-65202130 CCAAGGAGACAGATGATGAATGG + Intronic
1131708874 15:95030834-95030856 CCAAATAGACCCTTAATGAAGGG + Intergenic
1131718979 15:95146518-95146540 CCACTTAGACACATCTTTACTGG - Intergenic
1135790354 16:25388701-25388723 CCAATTTGAGACAACTTGAAGGG - Intergenic
1138883321 16:61043380-61043402 TCCATTAGACACTTCAAGAAAGG - Intergenic
1139046675 16:63069060-63069082 TCAATTACACACATTATTAATGG + Intergenic
1140305507 16:73799038-73799060 CCAAATAGACACATCAGGTTCGG - Intergenic
1140826965 16:78715830-78715852 CCAAATAGACACATGCAGAAGGG - Intronic
1147395120 17:40136709-40136731 CCAATTTTACACATCAGAAATGG - Intronic
1147627099 17:41907339-41907361 CCAAATAAACAGCTCATGAAGGG + Intronic
1153595698 18:6723011-6723033 CCATTTAAACCCATCAGGAAAGG - Intergenic
1155403178 18:25460704-25460726 CCAATTAGAGAGATAGTGAATGG + Intergenic
1157153025 18:45238307-45238329 CTAATAAGACACAAAATGAAAGG + Intronic
1158322421 18:56278228-56278250 AGAATTAGAGACAGCATGAAAGG - Intergenic
1166576035 19:43838777-43838799 CCAAAAAGCCATATCATGAAAGG - Intronic
1167781800 19:51603008-51603030 CTAATTAGACTGATCATTAAGGG + Intergenic
1167806726 19:51791875-51791897 CCAATTAGAAACATTCTCAAAGG + Intronic
925564269 2:5232820-5232842 CCAACTAAAAACATTATGAAGGG + Intergenic
925803936 2:7629923-7629945 CCAATTAGATACACCAAAAAGGG + Intergenic
927081097 2:19631248-19631270 CAAATTAGAAGCATCATGACAGG + Intergenic
930479912 2:51934896-51934918 CCAATTATACTCATCCTGAGAGG - Intergenic
930953803 2:57178399-57178421 CCAATGGGACACATCTTCAAGGG - Intergenic
931002268 2:57799653-57799675 CAAATTATAAACATCATGACTGG + Intergenic
933707206 2:85300654-85300676 CCAAATAGGCACCACATGAAAGG + Intronic
935543823 2:104379337-104379359 CCAATAAGAGACATCAGGTATGG - Intergenic
936588678 2:113782107-113782129 CCTAGGAGACACATCAGGAAAGG + Intergenic
939071331 2:137547630-137547652 GAAATTAGCCACATCAGGAACGG + Intronic
940315972 2:152327897-152327919 CAAATTCCACACATCCTGAAAGG - Intergenic
943279673 2:185916290-185916312 AAAATAAGACACATCATAAAAGG - Intergenic
946436277 2:219657982-219658004 CCAATTAGACACACAAGGAATGG - Intergenic
947318886 2:228895330-228895352 CCAATGAGAGACAACATGGAGGG - Intronic
1168866673 20:1092600-1092622 CCAATGAGATACATGAGGAAGGG - Intergenic
1170021762 20:11844543-11844565 CCAAATATACACATGCTGAAGGG + Intergenic
1171077499 20:22143707-22143729 CCATGCAGCCACATCATGAAAGG - Intergenic
1173757245 20:45527753-45527775 CCCATTTGGCACAGCATGAATGG - Intergenic
1178779395 21:35587399-35587421 GCAATTAGCCACATCCTGCATGG + Intronic
1182862504 22:33572246-33572268 CCACTCAGAAACAACATGAAAGG - Intronic
1183805250 22:40203911-40203933 CAAAATAGACACATCATAAAGGG - Intronic
949148084 3:728262-728284 CCAAATAGCCATATAATGAATGG - Intergenic
949218708 3:1602739-1602761 CCAATTAGACATTACAAGAATGG - Intergenic
949655235 3:6210224-6210246 CCACTGAGGCACAGCATGAATGG + Intergenic
949941324 3:9157015-9157037 ACAAATAGAAACATCTTGAAAGG - Intronic
954967719 3:54625902-54625924 CCAATTAGACACATCATGAATGG + Intronic
957371203 3:79296526-79296548 CAAGTTAGATACAACATGAAAGG - Intronic
959595131 3:108121405-108121427 CCAATTAGGCACACCATTAGGGG + Intergenic
960119240 3:113929841-113929863 CCCATTATACTCATCATCAAAGG - Intronic
960758569 3:121047880-121047902 CCAGCTAGAAACATGATGAAAGG - Intronic
962199685 3:133391062-133391084 CCAATTAGACACAGCCTTAATGG + Intronic
962949017 3:140200904-140200926 CCAAGTTGACACATCACCAAAGG + Intronic
964255267 3:154768201-154768223 CAAATTAGACACATTATGCTAGG + Intergenic
966964760 3:184979833-184979855 CCAACTAAACACATGATGACAGG - Intronic
970331407 4:14988320-14988342 CCTATAAGACAGATTATGAAAGG + Intergenic
970958880 4:21849275-21849297 TCAATTATGCACATCTTGAAAGG + Intronic
974965718 4:68758882-68758904 CCAGCTAAACACACCATGAAAGG - Intergenic
975529410 4:75385480-75385502 CCACTGAGACCCAACATGAAAGG - Intergenic
976561313 4:86504790-86504812 GCAATAAGACACATGATGACTGG + Intronic
977330954 4:95636644-95636666 GCAATAAGACACAACATAAAGGG - Intergenic
979184982 4:117776943-117776965 CCTATTGGATACATCAGGAATGG + Intergenic
980486109 4:133459806-133459828 CCAATGGGTCACATCATGATGGG - Intergenic
981510421 4:145550743-145550765 CCAGTTAGAAATATAATGAAAGG + Intronic
986608812 5:9546966-9546988 CCAATTATACACGTCTTCAAAGG - Intergenic
986983780 5:13477813-13477835 CCAATTTGGCCCATCAAGAATGG + Intergenic
987877401 5:23696246-23696268 CCACTTAGATACATAATGAAAGG + Intergenic
988515382 5:31899751-31899773 CAAATTAGAGCCCTCATGAATGG + Intronic
988714734 5:33814081-33814103 CTAATTAAAGACATCATTAAGGG - Intronic
989335571 5:40312772-40312794 CCATTAACACACTTCATGAAAGG - Intergenic
995779004 5:115755941-115755963 CCAAGTAGACAAATAGTGAATGG - Intergenic
996992443 5:129651257-129651279 CCAATTAGATATATCAACAAGGG - Intronic
999138143 5:149337408-149337430 CAAATTAGAAACATAATAAAAGG + Intronic
1004820786 6:19365868-19365890 CCAATTATACACATAAGGACTGG + Intergenic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1013942487 6:115681436-115681458 CCAGGCTGACACATCATGAAAGG - Intergenic
1014657335 6:124124360-124124382 CCAGTTAAACACAGCATTAATGG + Intronic
1016772884 6:147871715-147871737 CCTATTAGAGACATCAGGCAAGG + Intergenic
1018189119 6:161292863-161292885 CCAATTAGACACCCCATAATAGG - Intergenic
1021608720 7:22435266-22435288 CCTGTTAGACACAGCAGGAAAGG + Intronic
1022644905 7:32220851-32220873 CCAATTCCACATATCATGCATGG + Intronic
1029815276 7:103087895-103087917 CCAATTTGATACATTAAGAATGG - Intronic
1030978930 7:116163239-116163261 CCTATTAGTTACATTATGAAAGG - Intergenic
1031196791 7:118625744-118625766 CCAATTAAACACCTCTTAAATGG + Intergenic
1033066094 7:138155635-138155657 CCAAATATAAACATAATGAAAGG + Intergenic
1034473527 7:151269451-151269473 CCAATTAAAAACTTTATGAAAGG + Intronic
1034611308 7:152372137-152372159 CCAATAAGACACAGATTGAATGG + Intronic
1036758294 8:11486464-11486486 CCAATCAGACCCATCACTAATGG + Intergenic
1038193020 8:25341208-25341230 CCAATTAGACATCCCTTGAAAGG + Intronic
1038202285 8:25424401-25424423 CCAATTACATACACCATTAAAGG - Exonic
1043924766 8:86024521-86024543 CCAATTAAATAAACCATGAAAGG - Intronic
1044776931 8:95699650-95699672 CTTATCAGAGACATCATGAATGG + Intergenic
1047055905 8:121164878-121164900 CTAATGAAACACATCCTGAAGGG - Intergenic
1047164099 8:122417535-122417557 TCAATTAGATACATCATAAAGGG - Intergenic
1048204205 8:132402546-132402568 CCATTTAGAAACAGCATGCAAGG - Intronic
1056442395 9:86634029-86634051 CCAATTAAATATATCATGCAAGG - Intergenic
1059955448 9:119511051-119511073 CAAATTAAACACAGCATAAATGG + Intronic
1189364650 X:40379188-40379210 CCAATTGAACCCATCATGGAGGG - Intergenic
1191718354 X:64208368-64208390 TCAAGTAGACACATCATTACAGG + Intergenic
1194683127 X:96878712-96878734 CCAATTAGACTAATCCTGTAGGG + Intronic
1195388788 X:104339632-104339654 CAAATTAGTCACATGATGAAGGG - Intergenic
1195931106 X:110077488-110077510 CCAATTAACAACATCATGAAAGG - Intronic
1196255645 X:113515123-113515145 ACAATTAGACACATTGTGGAAGG - Intergenic
1198666383 X:139028108-139028130 CCACTTAAATACATCATGCAGGG + Intronic