ID: 954967720

View in Genome Browser
Species Human (GRCh38)
Location 3:54625903-54625925
Sequence CAATTAGACACATCATGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954967717_954967720 -8 Left 954967717 3:54625888-54625910 CCTAAGCAGTGTGGCCAATTAGA 0: 1
1: 0
2: 0
3: 11
4: 96
Right 954967720 3:54625903-54625925 CAATTAGACACATCATGAATGGG 0: 1
1: 0
2: 0
3: 9
4: 114
954967710_954967720 22 Left 954967710 3:54625858-54625880 CCATTTTGATTCCGTGATCATTT 0: 1
1: 0
2: 0
3: 33
4: 252
Right 954967720 3:54625903-54625925 CAATTAGACACATCATGAATGGG 0: 1
1: 0
2: 0
3: 9
4: 114
954967715_954967720 11 Left 954967715 3:54625869-54625891 CCGTGATCATTTTGGGGGTCCTA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 954967720 3:54625903-54625925 CAATTAGACACATCATGAATGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954967720 Original CRISPR CAATTAGACACATCATGAAT GGG Intronic
900901461 1:5519316-5519338 TAAATACACTCATCATGAATGGG + Intergenic
905281208 1:36850508-36850530 CAATGAGGCTCATGATGAATGGG - Intronic
911334783 1:96569588-96569610 GAATTGGACACATCATGTAATGG - Intergenic
915000732 1:152587545-152587567 AAATTGGACACTTGATGAATTGG + Intronic
916373887 1:164130352-164130374 TAATTTGACACAGCATCAATAGG - Intergenic
921698867 1:218244684-218244706 GAAATAGACACATCATGAGTAGG - Intergenic
1065499533 10:26365769-26365791 CAATGAGTCACAGCATGAGTAGG + Intergenic
1068071014 10:52195959-52195981 CCATTACACACATCACTAATTGG - Intronic
1068719406 10:60227320-60227342 GAAAAAGACATATCATGAATGGG - Intronic
1069806759 10:71131131-71131153 CAACCAGGCACATCTTGAATTGG - Intergenic
1070519181 10:77237219-77237241 CAATTAGACACTGCATGGAAAGG - Intronic
1071029656 10:81161479-81161501 CAATTACAAAAATAATGAATTGG - Intergenic
1072992489 10:100210438-100210460 CTGTTAGGCACTTCATGAATTGG - Intronic
1081333385 11:41832407-41832429 TCATTAGACAAATAATGAATGGG - Intergenic
1081457335 11:43236864-43236886 CAGTTAGCCAAGTCATGAATGGG + Intergenic
1087431447 11:98061220-98061242 GAAATAAACACATAATGAATTGG - Intergenic
1087963078 11:104376080-104376102 TAAGTAAACACAACATGAATAGG - Intergenic
1090879371 11:130820272-130820294 CAATTAGACATACCATAAAGTGG - Intergenic
1094123672 12:27000116-27000138 CATTTAGAGCCCTCATGAATGGG - Intronic
1094592571 12:31835406-31835428 CAATAGAACACATCATGCATTGG + Intergenic
1097660669 12:62427155-62427177 CAAGTAAACAAATCATGAATTGG + Intergenic
1097662206 12:62443305-62443327 AAATTCGACACTTGATGAATTGG - Intergenic
1099968428 12:89475536-89475558 TAATTAGATACATCAAAAATAGG + Intronic
1106442942 13:29795519-29795541 CAATTAGTAACATTATTAATAGG + Intronic
1107384907 13:39897712-39897734 CAATTACAAACACCATGAGTGGG + Intergenic
1109079711 13:57883309-57883331 CATTTAGAAACATCATTATTTGG + Intergenic
1109703848 13:66062723-66062745 AAAATAGACAAATCCTGAATAGG + Intergenic
1109874973 13:68389501-68389523 CAATTAGAAACATAATCAATTGG - Intergenic
1110786624 13:79536072-79536094 CAATTCTACACATCAGAAATAGG - Intronic
1111022604 13:82472809-82472831 CAATTACACACATATTGAAATGG - Intergenic
1113682960 13:112257131-112257153 CATTTACATACATCATGAATGGG - Intergenic
1115813909 14:37142097-37142119 CAATTAAGCACACCATAAATGGG - Intronic
1116449856 14:45051894-45051916 CCAATAAACCCATCATGAATAGG + Intronic
1116823140 14:49645083-49645105 CAAGTAGGTACATCATGTATAGG - Intronic
1128127236 15:65202109-65202131 CAAGGAGACAGATGATGAATGGG + Intronic
1131814707 15:96210376-96210398 CAAATAGACACATTATTATTTGG + Intergenic
1131852330 15:96556337-96556359 CACATAGACACAGCATTAATAGG - Intergenic
1137377207 16:47962416-47962438 AAATCAGACTCATCATGCATAGG - Intergenic
1144932551 17:18871490-18871512 CAATTAGACAAATCCATAATGGG - Intronic
1153014133 18:568136-568158 CAACTAAATACATCATGGATAGG - Intergenic
1157553297 18:48596096-48596118 AGATTACACAGATCATGAATGGG + Intronic
1158914453 18:62107885-62107907 CAATTAGTGACATCTTAAATTGG - Intronic
929239746 2:39642080-39642102 AAATTAGACACATTAGGAATTGG + Intergenic
931137775 2:59423369-59423391 GAAATAGCCACATAATGAATTGG - Intergenic
935443399 2:103130267-103130289 CAATTAAACACATCATTTTTGGG + Intergenic
935492558 2:103738158-103738180 CATTTAGACAGCTTATGAATTGG + Intergenic
935543822 2:104379336-104379358 CAATAAGAGACATCAGGTATGGG - Intergenic
940245416 2:151610180-151610202 CAATTACAGACAACATGAAATGG + Intronic
940490146 2:154349227-154349249 TAATTAGACACATAATTGATGGG + Intronic
942497036 2:176550658-176550680 CAATTAGCCAGATGATGAAAAGG - Intergenic
949428221 3:3942245-3942267 GAAATAAGCACATCATGAATAGG + Intronic
950298260 3:11850806-11850828 CAATTAGCCACATGTTCAATTGG + Intergenic
950855360 3:16099501-16099523 CAATTATACACATCCTCATTGGG - Intergenic
954967720 3:54625903-54625925 CAATTAGACACATCATGAATGGG + Intronic
955757329 3:62238657-62238679 CTGTTAGAATCATCATGAATGGG + Intronic
956302468 3:67787413-67787435 CAATCAGAAAAATAATGAATGGG + Intergenic
956384983 3:68707059-68707081 AAAATAAACACATCATGGATTGG + Intergenic
956620326 3:71215405-71215427 CAATTAGACACATAAATAAGTGG + Intronic
957161893 3:76620948-76620970 TCATTAGAAACATCATGTATAGG + Intronic
957840474 3:85662251-85662273 TACTTAGACATATCAAGAATGGG + Intronic
957908295 3:86585749-86585771 GAAGTAGATACTTCATGAATTGG - Intergenic
959513159 3:107236307-107236329 AAATAAAACACATCATGAAAAGG + Intergenic
960787946 3:121395176-121395198 CAATTATACACATCCTTACTTGG + Intronic
961580035 3:127873459-127873481 GAATTAGACACTACTTGAATAGG + Intergenic
962199686 3:133391063-133391085 CAATTAGACACAGCCTTAATGGG + Intronic
963667384 3:148205996-148206018 CACTTTGAAACATCATAAATAGG + Intergenic
964330966 3:155602198-155602220 CAATAAGACAAAGTATGAATAGG + Intronic
967235745 3:187382251-187382273 CACATAGATACATCATGGATTGG + Intergenic
967341848 3:188407206-188407228 CAACTGGAAACATCATGAAGAGG - Intronic
968020391 3:195381948-195381970 CAAATAAACAGTTCATGAATGGG - Exonic
970958881 4:21849276-21849298 CAATTATGCACATCTTGAAAGGG + Intronic
973203403 4:47531484-47531506 CAATAAGGCAGATCATGAAGAGG + Intronic
974156915 4:58085425-58085447 AAAATAGACACATAATTAATGGG + Intergenic
978039988 4:104048294-104048316 CAATTAGAGACATATTGGATGGG + Intergenic
981118527 4:141020741-141020763 GAAATAAACACATCATGAAATGG - Intronic
982592844 4:157336957-157336979 AAATTATACACACCATGAAGAGG + Intronic
987669853 5:20991971-20991993 CAATTAAAAACATTATAAATAGG + Intergenic
988515383 5:31899752-31899774 AAATTAGAGCCCTCATGAATGGG + Intronic
989220188 5:38950354-38950376 CAATTAGAGACTTCATTTATGGG - Exonic
994260935 5:97657828-97657850 TCATTAGAAACATTATGAATAGG - Intergenic
994985092 5:106922854-106922876 TAATTAGAAAAATCATGTATTGG + Intergenic
996391066 5:122962669-122962691 CAATTAGAAATATCAAAAATAGG + Intronic
1003510906 6:6779596-6779618 CAAACCGACACATCAAGAATAGG - Intergenic
1003693712 6:8380536-8380558 AATTTAAACACATCATAAATTGG - Intergenic
1008843342 6:55931505-55931527 CAATTAGACTAATCAACAATGGG + Intergenic
1010469328 6:76207488-76207510 TCATTAGACACAGTATGAATGGG - Intergenic
1011049421 6:83127884-83127906 CAATTATACACATTAGGAAATGG + Intronic
1013686390 6:112589618-112589640 TTATTATAAACATCATGAATTGG - Intergenic
1014657336 6:124124361-124124383 CAGTTAAACACAGCATTAATGGG + Intronic
1014857970 6:126426101-126426123 CATATAGACACAACATGAAGTGG + Intergenic
1018531247 6:164765826-164765848 AAATTAAACACATCATGTTTTGG + Intergenic
1020526862 7:9273182-9273204 AGATTGGGCACATCATGAATGGG + Intergenic
1025742610 7:64210770-64210792 CAATTATACACAACAAAAATGGG + Intronic
1025747640 7:64258190-64258212 CAATTATACACAACAAAAATGGG + Intronic
1026317247 7:69237907-69237929 CAAAAAGACACATCACGACTGGG + Intergenic
1026385558 7:69844065-69844087 CAATCAGCCAAATGATGAATAGG - Intronic
1028005755 7:85565012-85565034 CTCTTAGATACATTATGAATTGG - Intergenic
1028388231 7:90284577-90284599 CAATTAGACACTTAATGAGTAGG + Intronic
1029967823 7:104758686-104758708 CAACTAGTCACATGAGGAATGGG - Intronic
1033054600 7:138038643-138038665 CAATGAGACACAAGATTAATAGG + Intronic
1033455529 7:141499818-141499840 CAATCACACACATGAAGAATGGG + Intergenic
1033980563 7:147159730-147159752 CTATTAGATACATCATTAATTGG - Intronic
1042556787 8:70040145-70040167 AAATGAGACAAGTCATGAATGGG - Intergenic
1042685460 8:71434013-71434035 CCACAAAACACATCATGAATTGG - Intronic
1045095538 8:98793670-98793692 AAATTCAACACATGATGAATTGG + Intronic
1045323138 8:101096982-101097004 CCATTTGACAGCTCATGAATGGG - Intergenic
1046331444 8:112720641-112720663 CAATCAGTCACATCCTGGATAGG - Intronic
1048546267 8:135390396-135390418 CATTTAGACACATCTCCAATAGG - Intergenic
1055207869 9:73754322-73754344 CAATTACACTCATGAGGAATAGG - Intergenic
1059920104 9:119150725-119150747 CACTTAGTCAAATCATGAGTGGG + Intergenic
1061040981 9:128140244-128140266 CAATTAGAAACAATATGAGTGGG - Intergenic
1186529778 X:10283537-10283559 TAATTAAGCACATCATAAATGGG - Intergenic
1188269014 X:28115337-28115359 CAATTAAACATTTCATGAATTGG + Intergenic
1188885119 X:35539952-35539974 CAATTACACATAACATGAAATGG - Intergenic
1189595939 X:42565539-42565561 CAATTAGTAACATGATGAGTTGG + Intergenic
1189900985 X:45706068-45706090 CCATTAGACAAATTATGAAGTGG + Intergenic
1191718355 X:64208369-64208391 CAAGTAGACACATCATTACAGGG + Intergenic
1193432488 X:81425960-81425982 AAAGTATACACATCAAGAATGGG + Intergenic
1196255644 X:113515122-113515144 CAATTAGACACATTGTGGAAGGG - Intergenic
1196389785 X:115195370-115195392 GAATTAGAGAGATCAAGAATGGG + Intronic
1196672158 X:118380285-118380307 CAAATATACACATGATAAATTGG - Intronic
1197683813 X:129416712-129416734 GAATTAGACATGTAATGAATAGG + Intergenic
1199118502 X:144021695-144021717 ACATTAGGCACTTCATGAATCGG - Intergenic
1199633914 X:149796915-149796937 AAATAAGAGACATCTTGAATGGG - Intergenic