ID: 954967970

View in Genome Browser
Species Human (GRCh38)
Location 3:54627635-54627657
Sequence TCTTATGTTTTGAATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954967969_954967970 14 Left 954967969 3:54627598-54627620 CCATGAATATTGAAGGTAAGTTT 0: 1
1: 0
2: 1
3: 23
4: 277
Right 954967970 3:54627635-54627657 TCTTATGTTTTGAATGTAGAAGG 0: 1
1: 0
2: 1
3: 30
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954967970 Original CRISPR TCTTATGTTTTGAATGTAGA AGG Intronic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903313911 1:22485436-22485458 CCTTATATTTTTAATGTATATGG + Intronic
904204812 1:28847220-28847242 TTTTATGTTTTTAATAGAGATGG + Intronic
904640028 1:31919334-31919356 GCTTAAGTTTTGTATGTAGTTGG - Exonic
905194252 1:36262370-36262392 TATTATGTTTGGAATGTGGCAGG - Intronic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
908202626 1:61813119-61813141 TCTTAGGCTTTGAATGTGGGAGG - Intronic
909330330 1:74401751-74401773 TTTTATGGTTTGAATTTACATGG - Intronic
909377571 1:74957571-74957593 TTTTGTGTTTTTAGTGTAGACGG - Intergenic
909598556 1:77435475-77435497 TTTTATATTTTTAATGGAGATGG - Intronic
910276067 1:85450237-85450259 CTTTATGTTTTGCATGTAGTAGG + Intronic
910625194 1:89299340-89299362 ACTTTTATTTTGAATGTAAATGG + Intergenic
910803876 1:91171421-91171443 CCTAAGGTTTTGAAGGTAGAAGG + Intergenic
911531423 1:99047723-99047745 TCTTAACGTTTTAATGTAGATGG + Intergenic
911753664 1:101527839-101527861 TTTTAAATTTTGAAAGTAGAGGG - Intergenic
912247235 1:107972164-107972186 TTTTTGGTTTTGAATGTGGATGG - Intergenic
912792978 1:112671690-112671712 TCTTATGTTGAGAATGTTTAGGG + Intergenic
913968114 1:143393487-143393509 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
914062495 1:144219077-144219099 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
914116655 1:144747277-144747299 TCTTGTGTCTTGAAGGCAGAAGG + Intergenic
914233613 1:145788250-145788272 TTTTGTGTTTTTAATGGAGACGG + Intronic
915391206 1:155545848-155545870 TTTTATGTTTTTAATGGAGATGG - Intronic
916119613 1:161517099-161517121 TCTTAGTTTTTGAGTTTAGAGGG - Intronic
916129376 1:161598754-161598776 TCTTAGTTTTTGAGTTTAGAGGG - Intronic
916213563 1:162377411-162377433 TTTTATATTTTGAATAGAGATGG - Intronic
916609709 1:166379459-166379481 TGTTAAGTATTGAATTTAGAGGG - Intergenic
917614592 1:176727375-176727397 TCTTATGTTTAGGATATACATGG - Intronic
917822046 1:178772971-178772993 TTTTGTGTTTTTAATGGAGACGG + Intronic
918285083 1:183045139-183045161 TTTTTTGTTTTAAATGTATATGG + Intronic
918518994 1:185394170-185394192 TCTTTTTTTTTGTATTTAGATGG + Intergenic
918683586 1:187387001-187387023 TTTTATGTTTTTAATATACATGG - Intergenic
919144470 1:193616164-193616186 TCTTTTGTTTTATATGTAGAAGG - Intergenic
921483364 1:215689013-215689035 TATGATGGATTGAATGTAGAAGG + Intronic
921988529 1:221338814-221338836 TCTTATGTTTTGAAGCGGGAGGG + Intergenic
922517621 1:226220316-226220338 GCTTAGTTTTTGAATGTATATGG + Intergenic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
924028259 1:239860953-239860975 TCTTATTATTTGTATTTAGAGGG + Intronic
924187441 1:241509466-241509488 TATTATGTTTTAAAAGTACAGGG - Intronic
924524188 1:244832221-244832243 TTTTATATTTTTAATGGAGACGG - Intergenic
1062778386 10:175617-175639 TTTTCTGATTTGAGTGTAGAAGG + Intronic
1064177258 10:13085794-13085816 TTTTATGTTTTTAATAGAGATGG - Intronic
1064849886 10:19698777-19698799 CTTAATGTTTTGAAAGTAGATGG + Intronic
1065677457 10:28193382-28193404 TTTTATGTTTTTAGTGGAGACGG + Intronic
1065923133 10:30410862-30410884 TTTTATATTTTCAATGGAGATGG - Intergenic
1066222338 10:33347321-33347343 TCCTATCTTTTGTATTTAGAAGG - Intergenic
1067401271 10:45975970-45975992 TCTTGTGTTTTCAATAGAGACGG + Intronic
1067443024 10:46322284-46322306 TTTTATATTTTTAATGGAGATGG - Intronic
1067513194 10:46912123-46912145 ACTTATGTTTTGAATGTGTTAGG + Intronic
1067649059 10:48139719-48139741 ACTTATGTTTTGAATGTGTTAGG - Intergenic
1070039540 10:72762118-72762140 TTGTATGTTTTGATTTTAGAGGG - Intronic
1070501441 10:77076359-77076381 TCTTCTGATTTGAGTGTAAATGG - Intronic
1070530974 10:77337224-77337246 CCTAATGTTTTGACTTTAGATGG + Intronic
1071882370 10:89913160-89913182 TATTATGTTTTGATAATAGATGG + Intergenic
1072033375 10:91542183-91542205 TTTTGTATTTTTAATGTAGATGG + Intergenic
1072116304 10:92373427-92373449 ACTCATGTTGTGAATTTAGAAGG - Intergenic
1072556225 10:96515787-96515809 TTTTATGTTATTAAAGTAGAAGG + Intergenic
1072957350 10:99899020-99899042 TTTTATGTTTTTAGTATAGACGG - Intronic
1074658822 10:115627126-115627148 TGTAATGTTTTGAAACTAGATGG - Intronic
1075182009 10:120220068-120220090 TCTTATTTTATGAATGCAGTAGG + Intergenic
1078378334 11:10815920-10815942 TCTGATGGATTGAATATAGAAGG - Intronic
1079651855 11:22939852-22939874 TCATATTTTTTGACTGTAGAAGG - Intergenic
1080811675 11:35710636-35710658 TTTTATGTTATAAATGGAGAAGG - Intronic
1081134210 11:39418252-39418274 TCCTGTGTTTAGAATCTAGAAGG - Intergenic
1081344119 11:41961276-41961298 TTTTATGTTTTTAATAGAGACGG + Intergenic
1081445292 11:43125368-43125390 TCTTCAGTTTTTAATGTAAAAGG - Intergenic
1082642768 11:55685465-55685487 TATTATGTTTTGGGGGTAGAAGG - Intergenic
1086663382 11:89449956-89449978 TCTTATTTTTTGACTGTAAAAGG - Intronic
1087852773 11:103051629-103051651 TGCTATGCTTTGAATGTAGTGGG - Intergenic
1090888738 11:130903508-130903530 TCTTTTGATTTGAGTGTAGAGGG - Intronic
1092037608 12:5351341-5351363 TCTTATTTTGTGTATGTTGATGG - Intergenic
1093066622 12:14665039-14665061 TTTTATGTTTTTAGTGGAGACGG - Intronic
1093261040 12:16938404-16938426 TCTTATATTTTTAATAGAGATGG + Intergenic
1093295815 12:17389992-17390014 TCTTTTTTTTTGTATTTAGATGG - Intergenic
1093884136 12:24440171-24440193 TCTTATGGTTTAAATTTGGATGG + Intergenic
1094277772 12:28698018-28698040 TCACATGTTTTGAAGGGAGAGGG + Intergenic
1095535851 12:43246323-43246345 TGTTATGTATTGAATGTCAAGGG - Intergenic
1097004713 12:55907766-55907788 TTTTGTGTTTTTAATGGAGATGG - Intronic
1098243775 12:68494739-68494761 TCTGGTGTCTTGAATGTAGTAGG - Intergenic
1098278146 12:68834269-68834291 TTTTATGTTTTTAGTGGAGACGG - Intronic
1098734994 12:74090419-74090441 TCTTCTTTTTTTAATGTAGGTGG + Intergenic
1099967382 12:89463623-89463645 TCTCATGTTTTTAATTAAGATGG + Intronic
1100610384 12:96186898-96186920 TCTTTTGTTTTGATCCTAGAAGG - Intergenic
1100760885 12:97805412-97805434 AATTATTTTCTGAATGTAGAAGG - Intergenic
1100847211 12:98672333-98672355 TTTTATATTTTTAATGGAGATGG + Intronic
1101704130 12:107204975-107204997 TGTTATGTTTTGGAAGCAGATGG - Intergenic
1101957003 12:109220881-109220903 TATTATCTTTTGTATGTAGAAGG + Intronic
1102101930 12:110285925-110285947 TTTTTTTTTTTAAATGTAGATGG + Intronic
1104160827 12:126179239-126179261 TATTATTTTTTGAATGCTGATGG + Intergenic
1104294214 12:127496956-127496978 TATTATATTTTGAGAGTAGAAGG + Intergenic
1104297689 12:127532260-127532282 CCTTATGTTTTGAATGTTCCTGG + Intergenic
1106546562 13:30735807-30735829 TCTTTTTATTTGAATGTATAGGG + Intronic
1107270563 13:38610935-38610957 TCTTATGTTTTTAGTAGAGATGG - Intergenic
1108299515 13:49060471-49060493 TTTTATATTTTTAATGGAGATGG - Intronic
1108397292 13:50002216-50002238 TTTTATGTTTTTAATAGAGACGG - Intronic
1108905817 13:55471310-55471332 AATTATATTTTGAATGTAGTGGG - Intergenic
1109262559 13:60161360-60161382 TCTTGTTTTTTGGATGGAGAGGG - Intronic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1109368921 13:61396345-61396367 TCAATTGTTTTGAATGGAGATGG - Intergenic
1109634237 13:65092568-65092590 TTTTTTGTTTTGAAGATAGATGG + Intergenic
1109965115 13:69682588-69682610 TGTGATGTTTTGTATTTAGAAGG - Intergenic
1110109257 13:71722983-71723005 TCTGCTCTTTTGAATATAGATGG - Intronic
1110875018 13:80498436-80498458 TCTTTCTTTTTGAATGAAGATGG + Intergenic
1110897453 13:80772924-80772946 TTTTGTATTTTCAATGTAGACGG + Intergenic
1111024451 13:82500713-82500735 AGTTATATTTGGAATGTAGAGGG - Intergenic
1111340421 13:86878526-86878548 TTTTATATTTTTAATGGAGACGG + Intergenic
1111405451 13:87798544-87798566 TATTAAGTTTTAAATGTATATGG - Intergenic
1112914349 13:104528188-104528210 TCTAATGTTTTGAAAGTGGTGGG - Intergenic
1112930126 13:104724553-104724575 TCTTATCCTCTGTATGTAGACGG - Intergenic
1114394064 14:22340833-22340855 TATTTTGTTTTAAATGTAGTGGG - Intergenic
1114759431 14:25296769-25296791 TTTTATATTTTTAATGGAGATGG - Intergenic
1115251402 14:31352295-31352317 TCTTGTGTTTGGCATGTAGTAGG + Intronic
1116455284 14:45113529-45113551 TCTTATGTTTACACTGAAGAAGG + Intronic
1116924321 14:50618672-50618694 TCTTAAGTTTTGAATCTTTAAGG + Intronic
1117433123 14:55690024-55690046 TCTTATTTTTTAACTGAAGAGGG - Intronic
1120362040 14:83516324-83516346 TTTTATATTTTTAATGGAGACGG + Intergenic
1120441153 14:84541781-84541803 TCTGATGTACTGAATGTATAAGG + Intergenic
1123223369 14:106877252-106877274 CCTTATTTGTTGAATTTAGATGG + Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125988921 15:44085964-44085986 TCTGATGGTTTGAATGGAAATGG + Intronic
1126205206 15:46037509-46037531 TCTTCTGTTGTGAATGTATATGG + Intergenic
1126980173 15:54232908-54232930 TTTGATGTTTTGAATGTGGAAGG + Intronic
1128484944 15:68075951-68075973 TTTTATGTTTTTAGTGGAGATGG + Intronic
1129282244 15:74494902-74494924 TTTTATATTTTTAATATAGACGG + Intergenic
1129292931 15:74582336-74582358 TTTTATATTTTTAATATAGATGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130602093 15:85283036-85283058 TTTTGTGTTTTGATTTTAGACGG + Intergenic
1131325686 15:91441514-91441536 TCTCATGTTTTGAAAGTTGATGG - Intergenic
1131337706 15:91565621-91565643 TCTTAAATTTTTAATGGAGATGG + Intergenic
1132836495 16:1956122-1956144 ATTTAAGTTTTGAATGAAGAGGG + Intronic
1133081782 16:3327241-3327263 TTTTATTTTTTGCATTTAGAGGG + Intergenic
1134159663 16:11876736-11876758 TCTTTTGTTTTGTTTGGAGATGG - Intronic
1135565296 16:23507086-23507108 TCATGAGTCTTGAATGTAGAAGG - Intronic
1137455179 16:48612463-48612485 TTTTATATTTTGAATAGAGACGG - Intronic
1137586532 16:49667146-49667168 TCTTATTTTTTGGATGAGGAAGG - Intronic
1138103439 16:54273173-54273195 TCTTATATTTTTAATAGAGATGG - Intergenic
1140181813 16:72728004-72728026 TTTTATGTTTGGCATGTAGTAGG + Intergenic
1140562135 16:75995829-75995851 TTTTCTGTTTTTAATGGAGATGG - Intergenic
1140902677 16:79384271-79384293 TGTTATGTTTTTAGTATAGATGG - Intergenic
1143890676 17:10099808-10099830 TCTTAGGTTTTGAATATATTAGG - Intronic
1144489812 17:15699319-15699341 TCGTATGTTTTGAAAGCAAAAGG + Intergenic
1144911149 17:18682640-18682662 TCGTATGTTTTGAAAGCAAAAGG - Intergenic
1150230550 17:63547494-63547516 TCTTGTGTTTTTAAAATAGATGG - Intronic
1150872144 17:68924174-68924196 TTTTGTGTTTTGAATAGAGACGG - Intronic
1151243802 17:72778980-72779002 TCTTGTGTTGTGAATGCAGCTGG - Intronic
1151271212 17:72997421-72997443 TTTTATATTTTTAATGGAGATGG + Intronic
1152197690 17:78926842-78926864 TCTTGTGTTTTTAATAGAGACGG - Intergenic
1153156493 18:2155552-2155574 TCTCCTTTTTTGAATGTAGATGG - Intergenic
1153628890 18:7049672-7049694 TGTTTTGTTTTGATTTTAGATGG - Intronic
1154992367 18:21609036-21609058 TCTTTTGTTGTGAATGGAAAGGG - Intergenic
1155798468 18:30070297-30070319 TTTTGTATTTTGAATATAGATGG - Intergenic
1156383393 18:36583996-36584018 TTCTGTGTTTTGAATGGAGATGG + Intronic
1158144556 18:54297307-54297329 GTTTCTGTCTTGAATGTAGAGGG + Exonic
1158233673 18:55287837-55287859 TCTTATGTTTTTCATATAGCTGG + Intronic
1158370509 18:56797236-56797258 TCTAATCTTGTGGATGTAGAAGG + Intronic
1158430512 18:57381768-57381790 TCTTATGCTTAGAATATGGATGG + Intergenic
1160621800 18:80176457-80176479 TGTTCTGTTTTTAATGTTGAAGG - Intronic
1161938942 19:7390334-7390356 TTTTGTGTTTTTAATGGAGATGG - Intronic
1162172869 19:8805070-8805092 TCTTGTGTTTGGAATAAAGAGGG + Intergenic
1164267023 19:23628950-23628972 TTTTATGTTTTTAATAGAGACGG - Intronic
1164672422 19:30080251-30080273 TTTTATATTTTTAATGGAGATGG + Intergenic
1164815464 19:31197636-31197658 TATTATGCTTTGAATGTCCATGG - Intergenic
1165097967 19:33420234-33420256 ACTTATGTTTTATATGTACATGG + Intronic
1166008594 19:39924876-39924898 TTTTGTGTTTTTAATGGAGATGG - Intronic
1166027978 19:40106400-40106422 TTTTATATTATCAATGTAGAGGG - Intergenic
1166869216 19:45861080-45861102 TTTTATGTTTTGACTGGGGACGG - Intronic
1167555144 19:50190018-50190040 TCTTATATTTTTAGTGGAGACGG + Intronic
1167805611 19:51781996-51782018 TTTTATGTTTTTAGTGGAGACGG - Intronic
1168004071 19:53471927-53471949 TCTCATGTTATGTTTGTAGAAGG - Intronic
1202701902 1_KI270712v1_random:170955-170977 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
925041950 2:739385-739407 ACGTATGTTTTCAGTGTAGAAGG + Intergenic
925601140 2:5609807-5609829 TTTTAAGTTTTTAATGTACAGGG - Intergenic
926822438 2:16867227-16867249 TTTTATGTTTTGAAGATACAGGG + Intergenic
927226929 2:20776207-20776229 TCTTCTGTTTTGTTTGTATATGG + Intronic
929113940 2:38428667-38428689 TTTTATATTTTTAATGGAGACGG + Intergenic
929983770 2:46705470-46705492 TCTTCTGTGTTGATTGTTGAAGG + Intronic
930657996 2:54025944-54025966 TTTTATATTTTTAATGGAGATGG - Intronic
930910359 2:56622525-56622547 TCTTTTGTCTTAAATGTAGGAGG - Intergenic
931301390 2:60982066-60982088 TTTTATTTTTTTAATGGAGATGG - Intronic
931338041 2:61368781-61368803 TATAATGTTGTGAATGGAGAAGG + Intronic
933136690 2:78744749-78744771 TCCTATGTTTTGAAGGAAGCTGG + Intergenic
934172814 2:89554401-89554423 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
934283128 2:91628754-91628776 TCTTGTGTCTTGAAGGCAGAAGG - Intergenic
934584136 2:95474820-95474842 TCTTATGTTGTGAATTTGAAGGG + Intergenic
934595316 2:95601894-95601916 TCTTATGTTGTGAATTTGAAGGG - Intergenic
934649265 2:96080950-96080972 TCTAATGTCTTGAATCTATATGG - Intergenic
934787454 2:97023640-97023662 TCTTATGTTGTGAATTTGAAGGG + Intergenic
934953489 2:98595698-98595720 TCTCATGGTTTGAATGTAGTTGG - Intergenic
935469748 2:103443965-103443987 TTTTATGTCATGAATGCAGAGGG + Intergenic
935518215 2:104070793-104070815 TTTTATGTTTTGAATGTATCTGG - Intergenic
936669711 2:114643083-114643105 TCTGATGTTTTGAAAGATGAGGG - Intronic
936685747 2:114824123-114824145 TCTTATGTGTGGAATGAAGAGGG + Intronic
937035461 2:118777959-118777981 TTTTGTGTTTTTAATGGAGACGG + Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938581612 2:132651573-132651595 TGTTTTGTTTTGAAGGTACATGG - Intronic
938913017 2:135903378-135903400 TCTTGTATTTTCAAGGTAGATGG - Intergenic
939558148 2:143701868-143701890 TCTGTTTCTTTGAATGTAGATGG - Intronic
941014508 2:160339422-160339444 TCCTGTGTTTTGGATGTAGTTGG + Intronic
941085910 2:161118036-161118058 TCATATGTTTACAAGGTAGAAGG - Intergenic
942538391 2:176989694-176989716 TCTAATATCTTGAATGCAGATGG - Intergenic
943128604 2:183828015-183828037 TCTGATGGTTTAAATGTATATGG - Intergenic
943415874 2:187603325-187603347 TCTTTTGTTTTGATTGTCTATGG - Intergenic
943562625 2:189482188-189482210 TCCTATTTGTTGAATGAAGATGG + Intergenic
944607034 2:201361227-201361249 TCTTTTGTTTTGAAGGTAAAGGG - Intergenic
945607395 2:211952050-211952072 TCTAATCTTTTATATGTAGAGGG + Intronic
945675234 2:212847672-212847694 TCTTCTGTTTTTAATCTTGAGGG + Intergenic
946610575 2:221453597-221453619 TCTGCTGTTTAGAATATAGAGGG + Intronic
946663060 2:222021265-222021287 TTTTGTGTTTTTAATGGAGATGG - Intergenic
946861561 2:224004426-224004448 TTACATGTTTTGAATTTAGACGG - Intronic
1169890480 20:10446239-10446261 TTTTATGTTTTTAATAGAGACGG - Intronic
1170593047 20:17785860-17785882 TTTTATATTTTGAGTGTATAAGG - Intergenic
1172221010 20:33275069-33275091 TTTTATATTTTTAATGGAGACGG - Intronic
1172442518 20:34976235-34976257 TTGCCTGTTTTGAATGTAGATGG + Intronic
1172498467 20:35407255-35407277 TTTTATGTTTTTAATAGAGAGGG - Intronic
1172545992 20:35762054-35762076 TCTTGTTTTTTGAATATAAAAGG - Intergenic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1173365598 20:42381818-42381840 TTTTCTGTGTTGAAGGTAGAAGG - Intronic
1174448303 20:50604849-50604871 TCTTAGGTTATGCAGGTAGATGG + Intronic
1177057824 21:16330862-16330884 CTTTACCTTTTGAATGTAGATGG + Intergenic
1177077694 21:16598202-16598224 TCTCATGTTAGGAATGAAGAAGG - Intergenic
1177526031 21:22291054-22291076 TTTCATTTTGTGAATGTAGAAGG + Intergenic
1177709281 21:24750810-24750832 TCTTGTGTTTTGATGTTAGAGGG + Intergenic
1177869674 21:26556380-26556402 TCTTAGGTCTGGAATGTGGAAGG + Intronic
1178294650 21:31399003-31399025 TTTTATGTTTTTAGTGGAGATGG - Intronic
1178713297 21:34939945-34939967 TCTTTTGTTTTTAATTTAAAGGG + Intronic
1179285178 21:39971347-39971369 TTTTATTTTTTTTATGTAGATGG - Intergenic
1180575956 22:16774750-16774772 TCCTTTGTTTTGACAGTAGATGG + Intergenic
1180659097 22:17450171-17450193 TCTTAAGTTTTGAATATATATGG + Intronic
1182246402 22:28961302-28961324 TGCTATGGTTTGAATGTATATGG - Intronic
1182781332 22:32870838-32870860 TATTTTGTTTTGAATGGAAAAGG - Intronic
1182982252 22:34683527-34683549 GCTTATGTTTTCATTATAGAGGG - Intergenic
1185251810 22:49806055-49806077 TTTTATGTTTTCAGTGAAGATGG + Intronic
1185407373 22:50661258-50661280 TCTTGTGTTTTTAATAGAGACGG + Intergenic
949908654 3:8881703-8881725 GCTTCTGTTTAGCATGTAGAGGG + Intronic
952234121 3:31461566-31461588 TCTTATTTCTTGAAAGCAGATGG + Intergenic
954586510 3:51741395-51741417 GCTTTTGTTTAGAGTGTAGATGG - Intergenic
954967970 3:54627635-54627657 TCTTATGTTTTGAATGTAGAAGG + Intronic
955681833 3:61509532-61509554 TTTTGTGTTTTTAATATAGACGG + Intergenic
955702985 3:61700730-61700752 TTTTCTCTTCTGAATGTAGAAGG + Intronic
956774230 3:72551569-72551591 TTTTATGTTTTTAGTGGAGACGG - Intergenic
958016990 3:87949796-87949818 TCTTATGTTTTGAATTCCCAAGG - Intergenic
958528625 3:95294274-95294296 TCTTGTGTTTTTAGTGGAGACGG + Intergenic
958827754 3:99052303-99052325 TCTAATCTTTTGCATTTAGAGGG + Intergenic
958895133 3:99820832-99820854 TGTTTTGTTTTGAAAGTTGAAGG + Intronic
959093984 3:101933761-101933783 TCTTGTGTTTTTAGTGGAGATGG - Intergenic
959791969 3:110372788-110372810 TCCTATGTTTTAAATTTACATGG - Intergenic
960817418 3:121688356-121688378 TCGTATTTTTTGGATGGAGACGG + Intronic
963131387 3:141861500-141861522 TGTTTTGTTTTGAATGTCCAAGG - Intergenic
964397310 3:156258915-156258937 TGTTATGTTCTGCATGCAGAGGG - Intronic
965175904 3:165331955-165331977 TGTTATGTTTTCAATGAAAATGG + Intergenic
965199608 3:165640417-165640439 TCTTATTATTTGAAAGAAGATGG - Intergenic
965772160 3:172192682-172192704 TCTTATTTTATAAATGTTGACGG + Intronic
968918323 4:3508174-3508196 TTTTATATTTTTAATGGAGACGG + Exonic
969473250 4:7402318-7402340 TTTTATGTTTTTAATATAAAAGG - Intronic
970071773 4:12167393-12167415 TCTTTTGCTGTGAAGGTAGAAGG - Intergenic
970157456 4:13155342-13155364 TTTTTTTTTTTGAAAGTAGAAGG - Intergenic
971512261 4:27441469-27441491 TCTTCTGTTTAAACTGTAGAAGG + Intergenic
971886243 4:32452450-32452472 TCCTATCTTTTCAATGTAAATGG + Intergenic
973196750 4:47453018-47453040 TCATATGATTTGAATGTTTAAGG - Intronic
973870509 4:55161311-55161333 TATTATGGTTTGGATGGAGATGG - Intergenic
974394566 4:61318003-61318025 TCTTGTGTTTTTAATAGAGATGG - Intronic
974964335 4:68741941-68741963 ACTAATGTTTAGAATCTAGAAGG + Intergenic
975336608 4:73184053-73184075 CTTTGTGTTTTGAGTGTAGAAGG - Intronic
975618795 4:76275073-76275095 TCTTGTTTTTTGATTGTTGAAGG + Intronic
976807579 4:89065249-89065271 TCTTATGAATTGAATTTAAATGG - Intronic
976956637 4:90909514-90909536 ACTGATGTCTTGAATGTGGAGGG + Intronic
977149129 4:93487435-93487457 TCACAAGTTTTGAAAGTAGATGG - Intronic
977266533 4:94862631-94862653 TCTTATATTTTTATTGGAGACGG - Intronic
977684714 4:99835177-99835199 TTTTGTGTTTTTAATGGAGACGG + Intronic
977741256 4:100486397-100486419 TCTGATGTTTTCATTGTAAATGG - Intronic
979299301 4:119068237-119068259 TTTTATGTTTTTAATAGAGAGGG - Intergenic
979419954 4:120491352-120491374 TTTTATTTTTGAAATGTAGACGG - Intergenic
979574108 4:122266080-122266102 ACCTATATTTAGAATGTAGAAGG + Intronic
979736714 4:124095308-124095330 TCTTCTGATTTGAATGGTGAAGG + Intergenic
979912676 4:126389135-126389157 TCTCATGGTTTGAATGTAGTTGG + Intergenic
980650956 4:135714034-135714056 TTTTGTGTTTTTAATATAGACGG - Intergenic
980873715 4:138639257-138639279 TTTTATGTTTTGGGTGTACATGG + Intergenic
981318724 4:143367267-143367289 TCTAATGTTGTGCATGTAGTTGG + Intronic
982491061 4:156030261-156030283 TCTTGTATTTTTAATGGAGATGG + Intergenic
982797351 4:159662236-159662258 AATTCTGTTTTGAATGTGGAGGG - Intergenic
982998112 4:162377381-162377403 TCTTATATTTTGAAAGAAGAAGG - Intergenic
983843407 4:172484763-172484785 TCTTCTGTTTTGTGTGTAAATGG - Intronic
984145645 4:176056626-176056648 TTTTGTATTTTGAATGGAGAGGG - Intergenic
984666802 4:182437623-182437645 TTTTATGTTTTTAGTGGAGATGG - Intronic
985155736 4:186985268-186985290 TCTTATGCTTACAATGCAGAAGG - Intergenic
987211445 5:15687741-15687763 TCTTATTTTTTAAATCTACAAGG - Intronic
987287500 5:16471892-16471914 TATTATGTTTATAATCTAGATGG - Intergenic
987414950 5:17652638-17652660 TGTTATGTTTTCTATGAAGAAGG + Intergenic
987425724 5:17770755-17770777 TCTTTTTTTTTGTATATAGAAGG + Intergenic
987543151 5:19280637-19280659 TTTTATGTTTTTAATAGAGATGG + Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988022303 5:25636713-25636735 TATTGTGATCTGAATGTAGATGG - Intergenic
988312806 5:29583352-29583374 TATTATTTTTTAATTGTAGAGGG - Intergenic
989471512 5:41824539-41824561 GTTTATGTTTTTAATGTACAAGG - Intronic
989549126 5:42712104-42712126 ACTTCTGTTTTCAATGAAGATGG - Intronic
990137208 5:52660546-52660568 ACTTATGTGTTAACTGTAGAGGG - Intergenic
990170380 5:53041793-53041815 TTTTATGTTCTTAATGTAGCTGG + Intronic
990736123 5:58864524-58864546 TTTTGTGTTTTTAATGGAGATGG - Intergenic
990973949 5:61541112-61541134 TTTTATGTTTTTAATAGAGACGG + Intronic
991076649 5:62546849-62546871 TCTTCTGTTTAAAAAGTAGAAGG + Intronic
991338365 5:65576546-65576568 TTTTATGTTTTTAGTGGAGACGG + Intronic
991438450 5:66620306-66620328 TCATATGGTTTTAATGTGGAGGG - Intronic
992166071 5:74053222-74053244 TCCTATGTTTGTAATGTAGGAGG + Intergenic
992263280 5:74991957-74991979 TCCAATGTTTTAAATATAGATGG + Intergenic
992972479 5:82076536-82076558 TCTTGTGTTGTGAGTGTAGCAGG + Intronic
993050174 5:82917308-82917330 TCTTATTTGTTAAATGGAGATGG + Intergenic
993624277 5:90205288-90205310 TTTTATTTTTTGATTGTTGAAGG - Intergenic
994878658 5:105458756-105458778 TGTTATGTTTTTAATGGAAATGG - Intergenic
995583874 5:113626465-113626487 TTTTGTTTTTTGAATGGAGATGG - Intergenic
996178842 5:120393790-120393812 TCTTATTTTTTAAATGTAGCAGG - Intergenic
996444915 5:123536398-123536420 TCATATTTTTTCAATTTAGAAGG - Intronic
997552692 5:134767509-134767531 TTTTATGTTTTTAGTGGAGATGG + Intronic
998180920 5:139940831-139940853 TCTTTTTTTTTAAATGTACATGG - Intronic
1001376924 5:171268602-171268624 TCATGTGTTTTGCATGAAGAAGG + Intronic
1002796660 6:476780-476802 TCTTCTGTTTTTAATAGAGACGG + Intergenic
1003276052 6:4654009-4654031 TTTTATATTTTTAATGGAGATGG - Intergenic
1003723663 6:8734335-8734357 TCTTATGTTGTGACTGTATATGG + Intergenic
1003792083 6:9557492-9557514 TTTTATATTTTTAATGGAGACGG - Intergenic
1004382642 6:15145970-15145992 TCTTGTATTTTGAGTGTAGAAGG + Intergenic
1004951096 6:20672945-20672967 TTTTGTGTTTTTAATGGAGATGG + Intronic
1005216514 6:23534377-23534399 TATTATGTTTTTAAAGCAGAAGG + Intergenic
1005634721 6:27742316-27742338 TCTTTTGTTTTGTATGAAGCAGG - Intergenic
1005853362 6:29839817-29839839 TTTTGTGTTTTTAATATAGATGG - Intergenic
1006215253 6:32436624-32436646 TCTTATGTAGTGAATTGAGAAGG + Intergenic
1007244337 6:40449520-40449542 TCTACTGATTGGAATGTAGATGG + Intronic
1007443208 6:41882459-41882481 CCTTAAGTTTTTAATGTATATGG - Intronic
1010563729 6:77383314-77383336 TCTTATGTTTGGAATGTTTCTGG + Intergenic
1011144465 6:84197438-84197460 TCTTCTGTTTTCAATGTAAAAGG - Intronic
1011168424 6:84477529-84477551 TTTTAATTTTTGAAGGTAGAAGG - Intergenic
1011485022 6:87832311-87832333 TCTTGTGTTTTTAATATAAACGG - Intergenic
1012900152 6:104995709-104995731 TCTTCTGTTTCGGAAGTAGAAGG + Intronic
1013614203 6:111826471-111826493 TATTCTTGTTTGAATGTAGAAGG - Intronic
1013692255 6:112659713-112659735 TCTTATGCTTTGAATGCAGTTGG + Intergenic
1014647053 6:123986909-123986931 TGTTATGTGCTGAATGAAGATGG + Intronic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1015463835 6:133525065-133525087 ACTTATGTTGTGATTGGAGATGG + Intronic
1015937536 6:138418259-138418281 TCTTATGTATTGGAGGTAGGGGG + Exonic
1016760110 6:147727379-147727401 TATAATGTTTTGAATGTACCTGG + Intronic
1017471440 6:154740787-154740809 TGTTGTGTTTTGAATAGAGATGG + Intronic
1020649860 7:10861093-10861115 TCTTATGTCTTCAATGGTGAAGG - Intergenic
1021397391 7:20167198-20167220 TATTATTTTTTCAATGGAGATGG + Intronic
1021442930 7:20699528-20699550 TTTTATGTTTTTAATAGAGATGG - Intronic
1022247931 7:28578933-28578955 TCTCAAATTTTGAATGTAAAGGG + Intronic
1022662656 7:32381155-32381177 GCTTGTATTTTGAAGGTAGAGGG - Intergenic
1024812861 7:53234373-53234395 TCTTGTGTTTTTAGTGGAGACGG + Intergenic
1026347556 7:69487692-69487714 ACTTATGTTTTGAGTGCAGAAGG + Intergenic
1026500777 7:70941699-70941721 TCTTATATTTTTAATAGAGATGG - Intergenic
1028096241 7:86764546-86764568 TCTTGTGTTTTAAATGGAAAGGG + Intronic
1030428676 7:109414135-109414157 TCTTATGTTTAGAGTTTATATGG - Intergenic
1030562751 7:111111461-111111483 CCTTATGTGTTGAATAGAGAGGG - Intronic
1031175586 7:118344451-118344473 TCTTTTGTTTTGAAGATACACGG + Intergenic
1031575793 7:123414620-123414642 TGTTATGTTTTCAATGAAGATGG - Intergenic
1032186332 7:129730008-129730030 TTTTGTGTTTTTAATGGAGATGG + Intronic
1032212850 7:129931647-129931669 TGGTATGTTTTGAATGTAATTGG + Intronic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1034778621 7:153855832-153855854 TATTTTTTTTTGAATCTAGAAGG - Intergenic
1034986751 7:155520954-155520976 TTTTATATTTTTAATGGAGATGG - Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1036675276 8:10826741-10826763 TCATATGTTATGTTTGTAGATGG - Intronic
1037205009 8:16306497-16306519 TCAGATGTTATGAATGCAGAAGG - Intronic
1038787410 8:30631626-30631648 TCTTATTTTTTGTCAGTAGAAGG - Intronic
1039954909 8:42199695-42199717 TCTTCTGTTTTGATTGTGGGAGG - Intronic
1040029108 8:42808254-42808276 TTTTATGTTTTTAATAGAGACGG - Intergenic
1040520999 8:48176020-48176042 TGCTATGTTTTGAATGTAGATGG + Intergenic
1040853288 8:51924014-51924036 TCTTATGTTTGGAATGTTTCTGG - Intergenic
1041825315 8:62089337-62089359 CCTGATAGTTTGAATGTAGAAGG - Intergenic
1042586260 8:70342415-70342437 TTTTATGTTTTAAATTTTGAGGG - Intronic
1043779737 8:84316700-84316722 TCTTAGAATTTGAATTTAGAAGG + Intronic
1043956447 8:86365603-86365625 TCTTGTGTTTTGAATATGAATGG + Intronic
1044577234 8:93783154-93783176 TCTTGTGTTTTGCATAGAGATGG + Intronic
1044620880 8:94189737-94189759 TCTAGTGTTTTGAATTTATAAGG + Intronic
1044975022 8:97656069-97656091 TCTTAGGTTTAGAAACTAGAAGG - Intronic
1045201578 8:99988424-99988446 TCTTATGTTTTCAATCTGAAAGG - Intronic
1046413288 8:113876635-113876657 TCTAATGTCCTGAATGTATAAGG - Intergenic
1046423793 8:114019431-114019453 TCTTATGTTCTGATTGTTTATGG - Intergenic
1046809725 8:118519266-118519288 CCTTATGTGTTGAATGTAGCTGG - Intronic
1046951762 8:120026156-120026178 TTTTGTGTTTTTAATATAGACGG + Intronic
1048456833 8:134586019-134586041 TCCTATGTTTTGAGAGTAAACGG + Intronic
1048719382 8:137305469-137305491 TTTCATGTTTGGAATGAAGAGGG + Intergenic
1049590228 8:143455800-143455822 TTTTATGTTTTTAATAGAGACGG - Intronic
1050779392 9:9312300-9312322 TCTTATGCGTTGAATTTACATGG - Intronic
1050860570 9:10424207-10424229 TATTATGTTATGAATGTATCAGG + Intronic
1051685807 9:19657142-19657164 TGTCATGTTCTGAATGTAAACGG - Intronic
1052130667 9:24842683-24842705 TCTTTTTTTTTGCATGTGGATGG + Intergenic
1052207476 9:25860598-25860620 TGTTATGGCTTGAATGTCGATGG + Intergenic
1053401830 9:37831538-37831560 TTTTCTGGTTTGAATCTAGACGG + Intronic
1053719824 9:40934247-40934269 TTTTGTGTTTTTAATGGAGATGG - Intergenic
1054967111 9:71041817-71041839 TGTTCTGTTTTGAATATAGAGGG - Intronic
1055955602 9:81770491-81770513 TCTTGTGTTTTTAGTGGAGATGG - Intergenic
1056686775 9:88771541-88771563 TATTATCTTTTTAATGTACATGG + Intergenic
1060039649 9:120288880-120288902 TTTTGTGTTTTTAGTGTAGATGG - Intergenic
1060459923 9:123841804-123841826 TCTGATATATTGAATATAGAGGG + Intronic
1185557566 X:1033385-1033407 TCTTGTGTTTTTAATAGAGATGG + Intergenic
1185855395 X:3530119-3530141 TGTTATTCTTTGAAAGTAGATGG + Intergenic
1186098066 X:6124280-6124302 TCTTATATATTTAATGTATATGG - Intronic
1186686923 X:11934969-11934991 TCTTTTCTTGTGAATGTTGAAGG + Intergenic
1187063679 X:15812099-15812121 TTTTGTGTTTTTAATATAGATGG + Intronic
1187761059 X:22585705-22585727 TGTTTTGTTTTGAAGGTAGATGG - Intergenic
1187877462 X:23816178-23816200 TATTATGTCCTGAATCTAGAAGG + Intergenic
1188020391 X:25150912-25150934 TTTTATGTTTTTAATAGAGATGG + Intergenic
1188700620 X:33257212-33257234 TTTTATGTTTAGAATATAGAAGG - Intronic
1190814547 X:53917960-53917982 TTTTATGTTTTTAATAGAGATGG + Intergenic
1192635848 X:72816440-72816462 TATTTTGTTTTCAATGTTGACGG + Intronic
1192645866 X:72904363-72904385 TATTTTGTTTTCAATGTTGACGG - Intronic
1193150710 X:78121582-78121604 TCTTGTTTATTGAATGAAGAAGG + Intronic
1193962003 X:87938013-87938035 TCTTATGTTTTGAGGGGAAAAGG - Intergenic
1194560682 X:95415905-95415927 TCTTGTGTTTTGGATATAGTAGG - Intergenic
1194670243 X:96723029-96723051 TCTTATGCTATTAATGGAGAGGG + Intronic
1194850908 X:98867486-98867508 TCTTTTGATTTGAATGTGGAGGG + Intergenic
1194908079 X:99604026-99604048 TTTTGTGTTTTTAATGGAGACGG + Intergenic
1196140017 X:112250902-112250924 TTTTATGTTTTTAATATATATGG - Intergenic
1196255131 X:113509227-113509249 ATTTATTTTTTAAATGTAGATGG + Intergenic
1196960751 X:120998063-120998085 TTTTATGTTTTATATGTATAAGG + Intergenic
1197150091 X:123210661-123210683 TATCATGTTTTTAATGTTGAAGG + Intronic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1198497808 X:137210859-137210881 TCCAATGTTTGGAATTTAGATGG + Intergenic
1198545963 X:137693180-137693202 ACTTATATTTTGAATGTAAAAGG - Intergenic
1199509811 X:148609430-148609452 TATTAAGTTCTGAATGTACATGG + Intronic
1199702691 X:150395742-150395764 TATTATGCTTTGAATGTCCATGG + Intronic
1200341458 X:155401274-155401296 TCTTATGTTTGGAATTTACTAGG - Intergenic
1201326718 Y:12768475-12768497 TCTTATATTTTTAATAGAGATGG + Intronic
1201739674 Y:17310589-17310611 TTTTGTGTTTTTAATGGAGATGG - Intergenic
1201785716 Y:17775877-17775899 TTTTGTGTTTTTAGTGTAGATGG - Intergenic
1201815837 Y:18130111-18130133 TTTTGTGTTTTTAGTGTAGATGG + Intergenic
1201983392 Y:19932287-19932309 TATTTTGTTGTGAAAGTAGATGG + Intergenic
1202073971 Y:21020094-21020116 GCTTATGTTGTAAATGTAGTCGG - Intergenic
1202078671 Y:21061949-21061971 GCTTATGTTGTAAATGTAGTCGG - Intergenic