ID: 954969668

View in Genome Browser
Species Human (GRCh38)
Location 3:54640504-54640526
Sequence GCAGCTAGAGTGACTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954969668_954969669 -7 Left 954969668 3:54640504-54640526 CCATATTCAGTCACTCTAGCTGC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 954969669 3:54640520-54640542 TAGCTGCCTACCACTCACAAAGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954969668 Original CRISPR GCAGCTAGAGTGACTGAATA TGG (reversed) Intronic
902264213 1:15249773-15249795 GCAGAGAGAGTGACTGAGTGGGG - Intronic
907014228 1:50995843-50995865 GCAGCTACAATGACTGTATAAGG + Intergenic
909181947 1:72435472-72435494 GCATCTACAGTGATTGATTAGGG + Intergenic
909732245 1:78907780-78907802 GCAGCCAGTGTGACTGAATATGG + Intronic
910465520 1:87495038-87495060 ACAGCTAGAGTGATTGTGTATGG + Intergenic
912828509 1:112929029-112929051 GCAGCCAGAGTGTCTGTATTAGG - Intronic
914379219 1:147101355-147101377 GCTGCTGGAGAGAATGAATAGGG + Intergenic
915662191 1:157413725-157413747 GCAGCTTGTGTGACTGAGTCTGG - Intergenic
916399320 1:164428963-164428985 GAAGGTAGAGTGAGTGGATAGGG - Intergenic
918892191 1:190289436-190289458 TCAGATAGGGAGACTGAATATGG + Intronic
919072150 1:192769370-192769392 GTAGTTAGAGAGAATGAATAAGG + Intergenic
921344426 1:214167482-214167504 GCTTGTAGAGTGACTGAATGAGG + Intergenic
1063516475 10:6701126-6701148 GCAGCAAGAGTGACACAAAAGGG - Intergenic
1065183400 10:23149196-23149218 GCTGCTGGAGTGAGTGTATATGG - Intergenic
1067424982 10:46201828-46201850 GCAGCTAGCGTGACTTAGCAAGG - Intergenic
1069349341 10:67506988-67507010 CTAGCTAAAGAGACTGAATATGG - Intronic
1069963955 10:72098253-72098275 GCAGCCATAGTGCCTGAATAAGG + Intronic
1070861418 10:79667660-79667682 GCAGCTAGCGTGACTTAGCAAGG - Intergenic
1070875828 10:79807933-79807955 GCAGCTAGCGTGACTTAGCAAGG + Intergenic
1073618767 10:105025295-105025317 GCTGGTAGAATGAATGAATATGG + Intronic
1080835113 11:35933499-35933521 GTAGATAGACTGGCTGAATATGG + Intergenic
1085538732 11:77245800-77245822 GAAGCCAGCGTGACTGAAAAGGG - Intronic
1087912332 11:103768353-103768375 GCAGCCTGGGTGACAGAATAAGG - Intergenic
1088126978 11:106438715-106438737 GCAGCTAGAGTGAGTCGAGAAGG + Intergenic
1090240453 11:125177773-125177795 ACAGCTAGAATGGCTGACTAAGG + Intronic
1090961362 11:131560193-131560215 GCAAAAAGTGTGACTGAATAGGG - Intronic
1093019983 12:14194323-14194345 GCAGCAAGAGTGAAGGAAGAAGG - Intergenic
1093743497 12:22713957-22713979 GCATCTAGAATGACTAAAAATGG + Intergenic
1094826236 12:34271282-34271304 CCAGCTAGAGTGTCTTCATATGG - Intergenic
1095769946 12:45942554-45942576 GTGGCTAGAATGACTGAATTAGG - Intronic
1097492670 12:60290524-60290546 GGAGCTAGAGTGGCTGAAATGGG - Intergenic
1101269649 12:103130103-103130125 GCAGCTACAGTGTCTGCATCTGG - Intergenic
1103176631 12:118869595-118869617 GAAGCTAGAGTGCCTGGAGAGGG + Intergenic
1107761151 13:43680505-43680527 GCAGCAAGACTGAGTGCATAGGG + Intronic
1110469586 13:75843866-75843888 GCAGCCGGGATGACTGAATAGGG + Intronic
1111317674 13:86583084-86583106 GCAGCTAGATTGATAGAATGTGG + Intergenic
1116071427 14:40050998-40051020 ACATCTAGCTTGACTGAATAAGG + Intergenic
1117079157 14:52133467-52133489 GCAGCCAGAGACACTGAAGATGG - Intergenic
1119669006 14:76504689-76504711 GCAGCTCGAGAGTCTGAAGATGG + Intergenic
1119856260 14:77903515-77903537 GCAGCTAGGCTGAATGATTAAGG + Intronic
1122911694 14:104832226-104832248 GTAGCTAAAGTGGCTAAATAGGG - Intergenic
1124509403 15:30310268-30310290 GAAACTAGAGTCACTGAATTGGG + Intergenic
1124734157 15:32228394-32228416 GAAACTAGAGTCACTGAATTGGG - Intergenic
1126836497 15:52671860-52671882 GCAGCTAGTGGGGCTGGATATGG + Intronic
1127511479 15:59646002-59646024 CCAGCTTGAGTGACAGAGTAAGG + Intronic
1128650858 15:69412544-69412566 ACAGCTATAGTGAATGAATGTGG - Intergenic
1128905155 15:71460949-71460971 GCAGCAATAGTTAATGAATATGG - Intronic
1129130877 15:73493973-73493995 GGAGCAAGAGCTACTGAATAGGG - Intronic
1133462495 16:5999534-5999556 GCAGCAAGAGTGAAGGAAGAAGG + Intergenic
1135197622 16:20407694-20407716 GTAGTAAGAGTGAATGAATAAGG + Intergenic
1135887426 16:26323424-26323446 ACAGCTAGACAGAATGAATAAGG + Intergenic
1137054866 16:35740013-35740035 CCAGCTAGAGTGTCTTCATATGG + Intergenic
1137750264 16:50856420-50856442 GCAGCTCTAGTAACTGAATCGGG - Intergenic
1138261947 16:55630173-55630195 GCAGTTTGTCTGACTGAATAGGG + Intergenic
1144007748 17:11116387-11116409 GGAGCCAGGGAGACTGAATAGGG + Intergenic
1144318441 17:14087979-14088001 ACAGCTAGAGGGACTGAAAGGGG - Intronic
1145980693 17:29009679-29009701 TGAGCTACAGTGACTGAATTAGG + Intronic
1146621103 17:34398610-34398632 GCAGGCAGAGTGACTGACTTGGG + Intergenic
1149474328 17:56946807-56946829 GAACCAAAAGTGACTGAATAAGG + Intronic
1155387087 18:25290185-25290207 GCATCCAGAGTAACTGAAGAAGG + Intronic
1158549938 18:58427127-58427149 GGAGCTAGAGGAACTGAATGAGG + Intergenic
1159686993 18:71434829-71434851 GTAGTTAGAGTGAATGAATAAGG + Intergenic
1164810644 19:31152635-31152657 GGAGCTAGAGTTCCTGATTAGGG + Intergenic
927306397 2:21578489-21578511 GCAGCTAGAGTGCCTGGATTTGG + Intergenic
930286928 2:49441865-49441887 GTAACTAGAATGACAGAATAAGG + Intergenic
931488272 2:62716004-62716026 GAAGCTAGAGTGATAAAATAGGG - Intronic
933074355 2:77904825-77904847 GTAGCTTGAGTGAATGAATTAGG - Intergenic
935341530 2:102063735-102063757 GCAGCCAAAGTGACAGAATCAGG - Intergenic
937018354 2:118628109-118628131 CCAGCTTGAGTGACAGAACAAGG - Intergenic
938216985 2:129526443-129526465 CCAGCTTTAGTGACTGACTATGG + Intergenic
938945575 2:136209063-136209085 GCAGCAAGAGGGAGTGAACAAGG + Intergenic
942785773 2:179700379-179700401 AAACCTAGAGTGAATGAATATGG - Intronic
942893962 2:181027999-181028021 GGAAATAGAGTGACTGAATAGGG - Intronic
944911895 2:204318463-204318485 TCAGCTATAGTGACTTAATGAGG - Intergenic
945328661 2:208514422-208514444 GCAGCAAGAGTGAGAGAATGGGG + Intronic
945342518 2:208673966-208673988 TAAGCTAGAGTGACAGAATGAGG + Intronic
946389864 2:219408847-219408869 GGAGCTGGAGTGACTGTAAAAGG - Intergenic
946952959 2:224897495-224897517 ATAGCTAGAATGAATGAATAAGG - Intronic
948907893 2:240988531-240988553 GCAGCCAGAGTGACAGCTTAAGG - Intronic
1170002265 20:11627759-11627781 AAAGCTAGATTTACTGAATAAGG - Intergenic
1174274253 20:49392179-49392201 GCAGCAAGAGTGAGTGACTGAGG - Intronic
1174726363 20:52866681-52866703 GCAGTTAGAATGAGTGAACAAGG + Intergenic
1181882881 22:25995297-25995319 GTAGTTAGAATGAATGAATAAGG + Intronic
1182612680 22:31562405-31562427 GCAGCCTGAGTGACTGAGTTGGG + Intronic
1182888913 22:33799755-33799777 AAAGCAAGAGTGACTGAAAACGG + Intronic
949671538 3:6402464-6402486 CCAGCTAGGGTGTCTTAATATGG - Intergenic
950018014 3:9767848-9767870 GCAGGTTGAATGACTGAATGGGG - Intronic
950658816 3:14453922-14453944 GCAGCTAGGGTGGCTGAAGGAGG + Intronic
952030583 3:29137542-29137564 GAAGCTGGAGTGTCTGAATTTGG + Intergenic
954051825 3:47985407-47985429 CCAGCTAGGGTGACAGAGTAAGG + Intronic
954969668 3:54640504-54640526 GCAGCTAGAGTGACTGAATATGG - Intronic
956910955 3:73816524-73816546 GCAGCTAGAGTGAATTAATGAGG + Intergenic
957120986 3:76092043-76092065 GCATCTAGAGTGACAAACTATGG + Intronic
957693680 3:83604525-83604547 AATGCTAAAGTGACTGAATAAGG - Intergenic
958996896 3:100915481-100915503 GCAGCTGAAGTCGCTGAATAGGG + Intronic
960789750 3:121415520-121415542 GAAGCTATAGTGACTGAAAAAGG + Intronic
962880443 3:139571884-139571906 GCAGCCAGAGTGACTCAGGAGGG - Intronic
962982250 3:140501122-140501144 GGAGCGAGAGTGACTGATTTGGG - Intronic
965335603 3:167428314-167428336 CCAGCTAGAGTGTCTTCATATGG - Intergenic
975243062 4:72084907-72084929 GAAGCAAGAGTGAGTGAACAGGG - Intronic
977355314 4:95939097-95939119 ACAGCCAGAGTGGATGAATACGG - Intergenic
981554889 4:145982040-145982062 GGAGCTAGAGTCTCTTAATATGG + Intergenic
981907806 4:149942728-149942750 GCAGACAGAGGGACTGAAAATGG + Intergenic
988851391 5:35184579-35184601 TCAACTAGAATGACTGAATCAGG + Intronic
993673631 5:90792150-90792172 GTAGCTAGAGAGAATGAAAAAGG + Intronic
994830579 5:104777113-104777135 GCAGCTTGAGTTATTGAAGAAGG + Intergenic
996953338 5:129154367-129154389 GTAGGTAGATTGACTGAAAAGGG - Intergenic
999353394 5:150900005-150900027 GCAGCTTGACAGAGTGAATATGG - Intronic
1001248217 5:170121947-170121969 AAAGCTTGAGTGACTGAATTTGG + Intergenic
1004616196 6:17291937-17291959 GCAGCTGGAGAGGCTGCATAGGG - Exonic
1006557143 6:34876936-34876958 GCAATTAGAGATACTGAATAAGG - Exonic
1012353015 6:98276965-98276987 GCAGCTAGGCTGACAGAAAAGGG - Intergenic
1013567836 6:111386292-111386314 GCAGCTAAAATGAATGAACAAGG + Intronic
1016829871 6:148423578-148423600 GCAGATTGGGTGACTGAATAAGG - Intronic
1026744319 7:72999177-72999199 GCAGAAAGAGTGTGTGAATAGGG + Intergenic
1027030425 7:74883850-74883872 GCAGAAAGAGTGTGTGAATAGGG + Intergenic
1027099418 7:75365915-75365937 GCAGAAAGAGTGTGTGAATAGGG - Intergenic
1028944421 7:96560897-96560919 GCAGCTAGATCAACTGAATAAGG - Intronic
1034717404 7:153256263-153256285 GCAGGTAGAGTGCCTGAGTTAGG + Intergenic
1038646870 8:29369298-29369320 GCAGGTAGAGTGACAGAATTTGG + Intergenic
1039408386 8:37331716-37331738 GCAGCCAAAGTGAATGAATCTGG - Intergenic
1041195232 8:55395522-55395544 CCATCTAGAGAGACAGAATAAGG + Intronic
1042770290 8:72373116-72373138 TCAGCTACAGTGAATAAATAAGG + Intergenic
1047651389 8:126926445-126926467 GAAGCTGGAGTGACAGGATATGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1050480216 9:6080550-6080572 GCAGCCAGAGGGACGGAATCGGG - Intergenic
1051817128 9:21121319-21121341 GCAGCTTCAGGGACTGAATGAGG + Intergenic
1053470010 9:38339676-38339698 GGAGCAAGAGTGACAGAATTTGG + Intergenic
1056396410 9:86185501-86185523 TCAGCTAGAGCAACTGAACATGG + Intergenic
1058069863 9:100591038-100591060 GCAGCTAGAGAGATTGTATGAGG + Intergenic
1058072401 9:100614840-100614862 GTAGCTACAGTGATTGTATAAGG + Intergenic
1058969538 9:110068139-110068161 GCAGATAGAATGACAGAACATGG + Intronic
1059862904 9:118485056-118485078 GCAGCGGGAGTGACTGAACTTGG + Intergenic
1187696826 X:21930619-21930641 CCTGCTAGAGTGGCTGAATGGGG + Intergenic
1189614426 X:42768979-42769001 GCAGCAAGAGGGACTGTGTAAGG - Intergenic
1200183831 X:154168950-154168972 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200189485 X:154206078-154206100 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200195238 X:154243887-154243909 GAAGCTAGAGTGACAGAAACCGG + Intergenic
1200200890 X:154281008-154281030 GAAGCTAGAGTGACAGAAACCGG + Intronic