ID: 954971065

View in Genome Browser
Species Human (GRCh38)
Location 3:54652145-54652167
Sequence CAGCCAGAGTGACGGTCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954971065_954971067 -1 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971067 3:54652167-54652189 GTCTGTATTCTTCATCCCATAGG 0: 1
1: 0
2: 0
3: 11
4: 182
954971065_954971073 25 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971073 3:54652193-54652215 GGATTAATAAGGGATGTTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 132
954971065_954971070 14 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971070 3:54652182-54652204 CCCATAGGACTGGATTAATAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
954971065_954971074 28 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971074 3:54652196-54652218 TTAATAAGGGATGTTGAAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 198
954971065_954971068 4 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971068 3:54652172-54652194 TATTCTTCATCCCATAGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 129
954971065_954971072 15 Left 954971065 3:54652145-54652167 CCACACGACCGTCACTCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 954971072 3:54652183-54652205 CCATAGGACTGGATTAATAAGGG 0: 1
1: 0
2: 1
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954971065 Original CRISPR CAGCCAGAGTGACGGTCGTG TGG (reversed) Intronic
900334560 1:2155497-2155519 CAGCGACAGTGATGGTGGTGGGG + Intronic
902572702 1:17356819-17356841 CAGGCAGAGGGACGGGGGTGGGG + Intronic
906060862 1:42947751-42947773 CAGCCAGAGTGACGAGAGTAGGG + Intronic
915287497 1:154862295-154862317 CAGCCACCGTGAGGGTCATGAGG + Intronic
915468751 1:156113634-156113656 CAGCCAGAAAGAAGGTAGTGGGG - Intronic
921035807 1:211377015-211377037 CACCCAGACTGATGGTCTTGTGG - Intergenic
923984321 1:239363861-239363883 CAGCCTGGGTGACGGGAGTGAGG - Intergenic
1066529310 10:36319029-36319051 CAGACAGAGTGACTGTACTGTGG - Intergenic
1067800986 10:49359672-49359694 CAGCCTGAGTGGTGGTGGTGGGG - Intergenic
1070696981 10:78570818-78570840 CAGGCAGAGTGAGGATGGTGTGG - Intergenic
1071277511 10:84069178-84069200 CAGCCTGGGTGACGGGAGTGAGG + Intergenic
1071993868 10:91127857-91127879 CAGCCAGAGGGAAGATCATGTGG - Intergenic
1077503580 11:2920072-2920094 CAGCCAGAGTGCGGGGCGGGGGG + Intronic
1077908973 11:6557986-6558008 AAGCCAGAGTGATGGCAGTGTGG - Exonic
1079239391 11:18711970-18711992 CAGCCAGAGAGATGTTCCTGTGG + Intronic
1090738723 11:129636845-129636867 CAGCCAGAGGGATGGTAGCGAGG + Intergenic
1094058770 12:26291699-26291721 AAGCCAGAGTGACGGGAGGGTGG + Intronic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096400560 12:51302706-51302728 CAGCGAGTGGGACGGTCATGAGG - Exonic
1101118124 12:101551836-101551858 CAGCCAGGGTGAGGGGCGAGGGG - Intergenic
1103979830 12:124729636-124729658 CAGCCAGTGTGAAGGCCCTGAGG + Intergenic
1104976017 12:132552348-132552370 CAGCCAGAGGGACGGACGGACGG + Intronic
1105800784 13:23901527-23901549 CAGCCAGAGTGACAGCTGTTGGG + Intronic
1106404553 13:29462505-29462527 CAGCCAGGGTGGTGGTGGTGAGG + Intronic
1107631215 13:42344447-42344469 CAGACAGTGTGAGGGTGGTGGGG + Intergenic
1113830268 13:113290307-113290329 CAGCCACACTGAAGGACGTGAGG - Intergenic
1113909293 13:113834586-113834608 CTGCCACTGTGACGGGCGTGGGG - Exonic
1117207166 14:53455309-53455331 CAGAAAGAGTGAGGGTTGTGGGG + Intergenic
1122597013 14:102900647-102900669 CAGCCTGAGTGAAGGCCGCGTGG - Intronic
1126851818 15:52801722-52801744 CAGCCAGAGGGTCGGGCGTCGGG + Intergenic
1129362254 15:75031214-75031236 CAGCCTGAGAGAAGGTCCTGGGG + Intronic
1129780792 15:78269328-78269350 CAGCCAGAGTGGATGTGGTGTGG + Intronic
1132479791 16:161212-161234 CAGCCAGAGTCAGGGTAGGGGGG - Intronic
1132572121 16:648773-648795 CAGCCCCAGTGCCGGTAGTGGGG - Intronic
1133531302 16:6657505-6657527 CAGCCAGAGTGATTGCCGTCAGG + Intronic
1135817917 16:25652819-25652841 CAGCCAGAATGAAGGTCTTGAGG - Intergenic
1136287207 16:29251600-29251622 CACGCAGGGTGACGGTCCTGGGG - Intergenic
1140480657 16:75261292-75261314 CAGACAGAGGGAAGGTGGTGTGG + Intronic
1141848786 16:86629952-86629974 CAGCCAGTGTGAAGGCCCTGAGG + Intergenic
1141983008 16:87561427-87561449 CAGCCAGTGTAACGGCCCTGTGG + Intergenic
1142486871 17:253157-253179 CCACCAGAGTGAGGGGCGTGGGG + Intronic
1143688811 17:8542746-8542768 CAGCCTGAGTGACAGTGGAGTGG - Intronic
1146259873 17:31414354-31414376 CAGCCAGACTGACTGGCCTGTGG - Intronic
1147187714 17:38721872-38721894 CAGCCTGAGTGTGGGTCCTGGGG - Exonic
1147934782 17:44005274-44005296 CAGCCCGAGTGAGGATCCTGGGG + Intronic
1148159581 17:45442276-45442298 CAGCCAGAGGGAAGGTTGAGAGG - Intronic
1148773370 17:50079503-50079525 CAGCCAGAGTGACAGGTGGGGGG - Exonic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1157985611 18:52434813-52434835 CCTCCAGAGGGACGGGCGTGGGG - Intronic
1160731316 19:642846-642868 CACCCAGAGGGACGGACGTCAGG - Intronic
1161069840 19:2254494-2254516 CAGGCAGAGTCAAGGTTGTGGGG + Intronic
1163760579 19:19134221-19134243 CAGGAAGAGTGAGGGACGTGGGG + Intronic
925801325 2:7604774-7604796 CAGTCAGTGTGACGGTGGGGTGG + Intergenic
930781162 2:55225627-55225649 CAGGCAGCGTGACGGTCATGAGG - Intronic
939178051 2:138772758-138772780 CACCCAGAGTGATGGACTTGAGG - Intronic
942328870 2:174800641-174800663 CAGCCAGAGTGAAGGGAGGGTGG - Intronic
944269070 2:197760520-197760542 CAGCCAGAGTAACAGCCCTGTGG + Intronic
945768440 2:214009592-214009614 GAGGCAGAATGAGGGTCGTGAGG + Intronic
948540052 2:238684584-238684606 CAGCCAGGATGACGCTTGTGCGG + Intergenic
1171393186 20:24814667-24814689 CTGCCAGGGTGAAGGTGGTGGGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174361096 20:50029472-50029494 CAGCCAGTGTGAAGGCCCTGAGG + Intergenic
1179591648 21:42413095-42413117 GAGCCAGAGGCACGGCCGTGGGG - Exonic
1184669117 22:46003563-46003585 CAGCAAGACTGACTGTCTTGCGG - Intergenic
1184787715 22:46679939-46679961 CGGCCTGAGTGACGGCTGTGGGG + Intergenic
954279884 3:49569869-49569891 CAGCTGGAGTGACAGTCGTGTGG + Intronic
954971065 3:54652145-54652167 CAGCCAGAGTGACGGTCGTGTGG - Intronic
958700343 3:97581093-97581115 CAGACAGAGAGACGATCTTGAGG - Intronic
960581959 3:119288790-119288812 CAGCCAGAGTAACAGCCCTGTGG - Intergenic
963003008 3:140700764-140700786 CAGCCACTGTGGTGGTCGTGAGG + Intronic
966737766 3:183202468-183202490 CAGCCAGAGGTAAGATCGTGGGG - Intronic
968500008 4:945454-945476 CAGCCAGGGTGGTGGGCGTGAGG - Intronic
968627952 4:1636588-1636610 CAGCCAGTGTGAAGGCCCTGAGG - Intronic
984444879 4:179824353-179824375 CAGCCAGAGTGACCAACATGGGG + Intergenic
993833551 5:92788856-92788878 GAGCCAGAGTGACAGTGATGTGG - Intergenic
994388607 5:99162763-99162785 CAGCCAGAAAGACTGTCATGTGG + Intergenic
997411216 5:133692409-133692431 CAGCCAGAGGGATCTTCGTGAGG - Intergenic
1001719543 5:173845647-173845669 GAGCCAGAGTGCTGGCCGTGTGG - Intergenic
1010187034 6:73156807-73156829 CAGGCAGAGTGACTGTGGAGAGG + Intronic
1011470114 6:87700868-87700890 CAGCCAAAGTGGCGTTCTTGTGG + Intronic
1014607535 6:123495488-123495510 CAGCCTGAGTGACGAGAGTGAGG + Intronic
1016447407 6:144148219-144148241 CAGGAAGAGTGATGGTGGTGGGG - Intergenic
1019326289 7:439940-439962 AGGCGAGAGTGACGGTCCTGGGG + Intergenic
1019907139 7:4073284-4073306 CAGACAGAGTGGTGGGCGTGAGG - Intronic
1020094291 7:5359682-5359704 ATGGCAGAGTGACGGGCGTGGGG + Intronic
1024619881 7:51148235-51148257 CAGCCAGAGTGACTGGGGGGTGG + Intronic
1033016193 7:137674002-137674024 CAGCCAGAATCACTGTCGTTTGG - Intronic
1035159469 7:156940653-156940675 CAGCAAGAGTGCCGGGCATGAGG - Intergenic
1038613527 8:29073335-29073357 CAGACAGAGTGACCGACATGAGG - Intronic
1041245316 8:55883525-55883547 CAGCCCTAGTGACTGTCTTGGGG + Intronic
1046474429 8:114723096-114723118 CAGCAAGAGTGACGTTGGAGCGG + Intergenic
1046885615 8:119363754-119363776 CAGCAAGAGTGGGGGTTGTGAGG + Intergenic
1048330498 8:133467560-133467582 GAGCCAGAGTTAGGGTTGTGTGG - Intronic
1048335271 8:133497859-133497881 CAGCCACTGTGATGGTAGTGGGG + Intronic
1049596405 8:143485871-143485893 CAGCCAGCGGGATGGGCGTGAGG + Intronic
1049615211 8:143572924-143572946 CAGCCTGAGTGCCTGTGGTGTGG + Exonic
1050253767 9:3772820-3772842 CAGCTAGAGCGAAGGTCCTGAGG - Intergenic
1052903699 9:33816860-33816882 GCCCCAGAGTGACGGTTGTGCGG - Intergenic
1053211490 9:36232565-36232587 CAGCCAGTGTGAGGGCCGGGAGG - Intronic
1056519576 9:87387774-87387796 CAGCCAGAGAGAGGGTGGGGAGG - Intergenic
1056740909 9:89254865-89254887 CAGCCAGCGTGATGATCTTGGGG - Intergenic
1057006106 9:91561470-91561492 GAGCCAGAGGGACGGTCAAGTGG + Intergenic
1060504431 9:124187481-124187503 CAACTAGAGTGAGGGTCCTGCGG + Intergenic
1061627306 9:131848633-131848655 GAGTCAGAGTGACGGCTGTGAGG + Intergenic
1061805149 9:133133593-133133615 CAGCCAGAGTTGCGGTGGGGAGG - Intronic
1189159948 X:38801402-38801424 AAGCCAGAGGGGCGGTGGTGGGG + Intergenic
1189394341 X:40607491-40607513 CTGCCAGAGTGATGGGGGTGAGG + Intergenic
1196535590 X:116839551-116839573 CAGCAAGAGTCACTGTCGTGGGG + Intergenic