ID: 954971643

View in Genome Browser
Species Human (GRCh38)
Location 3:54656401-54656423
Sequence AGACCAGCAGCCTCTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954971643_954971650 24 Left 954971643 3:54656401-54656423 CCTCCAACAGAGGCTGCTGGTCT 0: 1
1: 0
2: 2
3: 22
4: 197
Right 954971650 3:54656448-54656470 GCATCCCAGGAGAGCCAGCCTGG 0: 1
1: 0
2: 5
3: 29
4: 383
954971643_954971647 11 Left 954971643 3:54656401-54656423 CCTCCAACAGAGGCTGCTGGTCT 0: 1
1: 0
2: 2
3: 22
4: 197
Right 954971647 3:54656435-54656457 AAACTGCCCAGTGGCATCCCAGG 0: 1
1: 0
2: 3
3: 25
4: 206
954971643_954971646 2 Left 954971643 3:54656401-54656423 CCTCCAACAGAGGCTGCTGGTCT 0: 1
1: 0
2: 2
3: 22
4: 197
Right 954971646 3:54656426-54656448 GGCAGTCAGAAACTGCCCAGTGG 0: 1
1: 0
2: 2
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954971643 Original CRISPR AGACCAGCAGCCTCTGTTGG AGG (reversed) Intronic
900352129 1:2240171-2240193 AGGACAGCAGCCTCTGTGGTGGG - Intronic
900541137 1:3203504-3203526 AGGCCAGAAGCCCCTGATGGAGG + Intronic
900655259 1:3753776-3753798 TGACCAGCAGCATGTGTGGGTGG + Intronic
901146782 1:7070182-7070204 AGAACAGCAGCATCAGATGGGGG + Intronic
902301940 1:15508012-15508034 AGACCCTCAGACTCTGCTGGTGG + Intronic
902807934 1:18872447-18872469 AGGCCAGGAGCCTCTGTGAGTGG + Exonic
902875199 1:19336808-19336830 AGCCTAGCAGCCTCTGCTGCAGG + Intergenic
903382181 1:22905062-22905084 AGACCAGCTGCCTATCTGGGAGG + Intronic
903632767 1:24788988-24789010 AGACTTCCATCCTCTGTTGGTGG + Intronic
904187430 1:28716344-28716366 AAACCAGCTGCCTTTTTTGGTGG + Intronic
905741310 1:40373869-40373891 GGCCCCGCAGCCTCTCTTGGAGG + Exonic
907110956 1:51925950-51925972 AGAGGAGCAGCCCCTGCTGGGGG + Intronic
911599213 1:99830214-99830236 ATAGCAGCAGTCTCTGTTGTGGG + Intergenic
912312186 1:108633896-108633918 AGACCAGCAGGCTGTGTTTGGGG + Intronic
912444059 1:109720913-109720935 AACACAGCAGCCTGTGTTGGCGG + Intronic
914328941 1:146648239-146648261 ACACCAGCAGCCTCTATTGATGG + Intergenic
915702728 1:157811502-157811524 ACACCAGCAGTCTTTGTTGCTGG + Intronic
919785207 1:201254290-201254312 ACTCCACCAGCCTCTGCTGGGGG + Intergenic
922449399 1:225724631-225724653 AGACCAGCAGAGTCTATTTGTGG + Intergenic
922675759 1:227547939-227547961 AGCCCAGCAGGCTGTGGTGGGGG - Intergenic
923758794 1:236820022-236820044 TGACCAGCAGCCTCTCATGGAGG + Intronic
924643579 1:245856806-245856828 GAACCAGCAGCTGCTGTTGGGGG + Intronic
1063565821 10:7171773-7171795 AGAGCAGCTGCTGCTGTTGGAGG + Intronic
1067297634 10:44983931-44983953 AGACCAGCAGCCCCTGGGGTAGG - Intronic
1067764779 10:49076555-49076577 TGCCCAGCAGCTCCTGTTGGAGG - Intronic
1068913991 10:62408663-62408685 ATACTAACAGCATCTGTTGGGGG + Intronic
1069954006 10:72038715-72038737 AGACCAGCAGCCCATTTTGGAGG - Intergenic
1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG + Intronic
1070696476 10:78567541-78567563 AGACAAGCAGCCTCAGATGAGGG + Intergenic
1070955100 10:80458435-80458457 GGGCCAGCAGACACTGTTGGAGG + Intronic
1071007018 10:80894951-80894973 AGACCTGAAGCCGCTGGTGGAGG + Intergenic
1071393409 10:85197927-85197949 TGAACAGCAGCCTCTTTTAGTGG - Intergenic
1071566624 10:86674506-86674528 ACACCTGCAGCCTTTCTTGGGGG + Intronic
1072513483 10:96152325-96152347 AAACCAGCAATCTTTGTTGGTGG + Intronic
1073142966 10:101261199-101261221 AGGCCAGCAGCCTCTGGCCGCGG - Intergenic
1075095371 10:119467708-119467730 AGACCAGCAGCCTCTCCTGGGGG + Intergenic
1076246678 10:128952437-128952459 TGACCAGCAGCCTCAGAGGGAGG + Intergenic
1076367789 10:129933598-129933620 AGCCCAGCAGCCTCTGCAGGCGG + Intronic
1076505643 10:130971088-130971110 AGACCAATGGCGTCTGTTGGTGG + Intergenic
1076996525 11:299782-299804 TGGCCAGCAGCCTTTGATGGGGG - Intergenic
1077134894 11:993637-993659 CGACCAGCGGCCTCTGGTGCAGG + Intronic
1081092953 11:38895763-38895785 AAACCAGCAGCTTGTATTGGTGG - Intergenic
1083794466 11:65006968-65006990 AGCCCAGCTGCCTGTGTGGGAGG - Intergenic
1085407254 11:76270498-76270520 GCACCAGCAGCCTCTGCTGAGGG - Intergenic
1087841629 11:102926692-102926714 AGGCCATCAGCCACTCTTGGTGG - Intergenic
1088042803 11:105408077-105408099 AAAACAGCAGCCTCTATTGATGG + Intergenic
1089689661 11:120179395-120179417 GGGCCGGCAGTCTCTGTTGGGGG + Intronic
1090091796 11:123704486-123704508 AAACCAGGAACTTCTGTTGGAGG + Intergenic
1091836168 12:3587764-3587786 AGAACAGAAGACTCAGTTGGGGG - Intronic
1095273846 12:40255571-40255593 GGACCAGCAGCATTTGCTGGGGG + Intronic
1095938266 12:47708471-47708493 TAACCAGCAGCCTCTGTCAGGGG + Intergenic
1096500805 12:52062954-52062976 AAACCTCCAGCCTCTGATGGTGG + Intergenic
1096521823 12:52188829-52188851 CAGCCAGCAGCCTCTGCTGGAGG + Intronic
1096585176 12:52615227-52615249 AGCCCAGCACCCACTGCTGGGGG + Intronic
1097042766 12:56165518-56165540 GGCCCAGCAGCCCCTGTTGGGGG + Exonic
1098938273 12:76505065-76505087 AGATCAGCCTCCTCTATTGGAGG - Intronic
1099142050 12:78990181-78990203 TCACCAGCAGCCTCTGTGAGAGG + Intronic
1102270358 12:111529469-111529491 AGACTAGCAGGCGATGTTGGAGG + Intronic
1103165062 12:118763375-118763397 AGACAAGCAGCCTTTCTTGGGGG - Intergenic
1109308740 13:60667669-60667691 AGATCAGGAGCCTTTGGTGGAGG + Intergenic
1110280893 13:73693390-73693412 AGAACTGCAGCCCTTGTTGGAGG + Exonic
1111957025 13:94770468-94770490 AGAAAAGCAGCCTCAGTTAGTGG - Intergenic
1112858592 13:103802241-103802263 AGACCAGCATTCCCTCTTGGAGG - Intergenic
1113500819 13:110772687-110772709 TGTCCAGCAGTCCCTGTTGGGGG - Intergenic
1113521608 13:110946010-110946032 AGAGGATCAGGCTCTGTTGGGGG - Intergenic
1113592038 13:111507820-111507842 CCACCAGCAGCCTTTGTTTGAGG + Intergenic
1113818250 13:113190829-113190851 CGACCACCAGACGCTGTTGGTGG - Intronic
1113850947 13:113417597-113417619 TGACCAGCAGCCGCTGCTCGGGG + Intergenic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1114699091 14:24658883-24658905 AGACCAGCAGTTTCTTCTGGAGG - Intergenic
1116755197 14:48939688-48939710 AGGGCAGCTGCCTCTGATGGAGG + Intergenic
1117337252 14:54765992-54766014 TGACCAGCCGCCTAGGTTGGGGG + Intronic
1118598379 14:67453565-67453587 AGGCCATCAGCATCTTTTGGGGG - Intronic
1121524099 14:94606544-94606566 AGAAGAGCAACCTCTGTAGGAGG - Intronic
1122724477 14:103741236-103741258 ACACCATCAGCCTCTGTGGTAGG + Intronic
1126060436 15:44775970-44775992 AGACCAGCAGCTCATGTTGCAGG - Intergenic
1126861353 15:52885972-52885994 TGACCACCAGCCTCTCATGGAGG + Intergenic
1127156421 15:56130933-56130955 AGGCCTGGAGCCTTTGTTGGAGG - Intronic
1127472404 15:59302048-59302070 AGAACTAAAGCCTCTGTTGGAGG + Intronic
1128519710 15:68367279-68367301 GGACCAGGAGCTTCTCTTGGTGG + Intronic
1128555512 15:68629068-68629090 AGACCAGCAAGGTCTGCTGGGGG + Intronic
1129717009 15:77858361-77858383 GGGCCAGCACTCTCTGTTGGTGG - Intergenic
1130295783 15:82646684-82646706 AGACCAGAAGGCTCTGTGAGCGG - Intronic
1130460444 15:84155692-84155714 AAGCCACCAGCCTCTATTGGGGG + Intergenic
1131259018 15:90879029-90879051 TGTCCAGCACCCTCTTTTGGAGG + Intronic
1132146149 15:99431220-99431242 TGACCAGCTACCTCTGCTGGTGG + Intergenic
1134276938 16:12785077-12785099 AGACCACCAGCTTCTGTAGCAGG - Intronic
1134863198 16:17579396-17579418 ATTCCAGCAGCCTCTGATTGAGG + Intergenic
1135587441 16:23681542-23681564 AGACCATCAGCAGCGGTTGGTGG + Intronic
1135698399 16:24610412-24610434 AGACCAGGCCCCTCTGCTGGGGG + Intergenic
1137433520 16:48437167-48437189 AGCCCAGAAGCCAGTGTTGGTGG + Intronic
1137719896 16:50621822-50621844 TGAACAGCACCCTCTGTGGGAGG + Intronic
1138039076 16:53642782-53642804 GGACTGGCAGCCTCTGTTGTAGG + Intronic
1139708797 16:68760886-68760908 AGACTCTCAGCCTCTGTTGTTGG + Intronic
1139967592 16:70754382-70754404 GTACCAGCAGCCACTGCTGGGGG - Intronic
1140004625 16:71062704-71062726 ACACCAGCAGCCTCTATTGATGG - Intronic
1141196697 16:81866094-81866116 AGACCAGCATCCTCTCATGCTGG - Intronic
1141901428 16:86993665-86993687 AGACCAGCGGCCTGTGCTTGTGG - Intergenic
1141968916 16:87466613-87466635 AGACCCACAGACTCTGTTCGAGG - Intronic
1143015759 17:3890375-3890397 AGACCATCAGCCTCCGTGGGTGG - Intronic
1143379349 17:6486326-6486348 GGAGCAGCAGGCTCTGGTGGGGG - Intronic
1144173479 17:12682349-12682371 AGACCAGAAGCCTCTGATGGTGG + Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1149300649 17:55302142-55302164 AGACCATCAGCCTCTCCTGCAGG - Intronic
1151670675 17:75570226-75570248 AGACCTGCCGCCGCTGCTGGTGG - Exonic
1152585973 17:81189658-81189680 CAACCACCAGCCTCTGTGGGGGG + Exonic
1152813214 17:82391979-82392001 GGGCCAGCAGCTTCTGTTCGGGG - Intronic
1153948860 18:10040383-10040405 AAACCAGCAGCCACTGGAGGGGG + Intergenic
1154954888 18:21243321-21243343 GGACCCGCAGCCTCGGTTAGAGG - Intronic
1157302097 18:46486454-46486476 AGACAGGCAGCCTCTGATAGAGG + Intronic
1163127739 19:15253407-15253429 TGAGCAGCAGCCTCAGTGGGAGG - Intronic
1165045031 19:33097980-33098002 GGAGCACCAGCCTCTGTTGTTGG + Intronic
1165079063 19:33297502-33297524 AGACCAGCAGCTCCTGGAGGAGG + Intergenic
1166375632 19:42325550-42325572 AGCCGAGCAGCCGCTGTGGGAGG - Intergenic
1166746263 19:45143299-45143321 AGATCAGAAGCATCTGGTGGAGG + Intronic
1167029957 19:46951767-46951789 AGACCAGGAGCCTCTGCATGGGG - Intronic
1167765266 19:51478540-51478562 AGACCGGCAGCCTCTGTGCCAGG + Intergenic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
925839437 2:7977915-7977937 AGACCAGCAGCCTTTTTTTTTGG - Intergenic
927360729 2:22229855-22229877 AGACAAGCAGCCACTGAAGGGGG - Intergenic
931423171 2:62146763-62146785 TGACCACCAGCCTCTCATGGAGG + Intronic
934561321 2:95314996-95315018 AGGCCAGCTGCCTCTGGGGGTGG + Intronic
935433643 2:103004528-103004550 CCACCTGCAGCCTCTCTTGGAGG + Intergenic
935677742 2:105610128-105610150 GGACCAGCAGCCTCTCTTGCGGG + Intergenic
936081291 2:109434316-109434338 AGAGCAGCAGCTTCTGAGGGAGG + Intronic
940955777 2:159725827-159725849 TGACTAGCAGCCTTTGTTGTAGG + Intronic
946065889 2:216986849-216986871 AGAGTAGCAGCCTCTGCTCGGGG + Intergenic
946130846 2:217605483-217605505 AGACTGGCAGCCTCTGCTGCAGG + Intronic
946751919 2:222900723-222900745 GGACCAGCAGCTTCTGAGGGTGG - Exonic
948025230 2:234771240-234771262 AGAACATCAGCCCCGGTTGGGGG - Intergenic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1168876536 20:1175922-1175944 AGACCAGCAGGCCCAGATGGAGG + Intronic
1171184684 20:23116897-23116919 AGAGCAGCAGCCTGATTTGGAGG - Intergenic
1171994791 20:31723195-31723217 AAACCAGCGGCATTTGTTGGGGG - Intronic
1173168981 20:40707154-40707176 AGCCCAGCTGCCTCTGCTGTGGG + Intergenic
1173908709 20:46648076-46648098 AGTCCACCAGCCTCTGTTTGGGG + Intronic
1174106681 20:48167185-48167207 AGGCCACCACTCTCTGTTGGTGG + Intergenic
1174358598 20:50014452-50014474 AGACCAGCAGCCACTGGCCGAGG - Intergenic
1175786854 20:61717338-61717360 AGAGCAGCAGCGTCTGTGGCTGG - Intronic
1175886655 20:62295694-62295716 AGCCCAGGTGCCTCTGGTGGAGG + Exonic
1176102742 20:63372015-63372037 AGCCCAGCAGCATCTCGTGGAGG + Intronic
1176110141 20:63407375-63407397 AGCCCAGCAGCCCCTTTTGCAGG - Exonic
1179974137 21:44854121-44854143 AGCCCAGCAGCCACTGTGAGCGG - Intronic
1180092424 21:45539913-45539935 GGACCAGCACCCTCCATTGGAGG + Intronic
1181956226 22:26589735-26589757 AGACGCTCAGCGTCTGTTGGCGG - Intronic
1182961317 22:34478025-34478047 AATCCAGCATCCTCTCTTGGGGG - Intergenic
1183488645 22:38104894-38104916 AGACCAGCGGCCGCTTTTAGAGG + Intronic
950475026 3:13209680-13209702 ATACCAGCTGCCTATGCTGGGGG + Intergenic
950559774 3:13714768-13714790 AGACCAGCTGCCTCACATGGGGG - Intergenic
951373859 3:21888955-21888977 AGACCTGCAGCCTCTTTTATTGG - Intronic
952883114 3:37997776-37997798 AACCCAGCAGCCTTTGCTGGAGG - Intronic
954193632 3:48982901-48982923 ATACCAGCAGGCTCAGCTGGAGG + Exonic
954971643 3:54656401-54656423 AGACCAGCAGCCTCTGTTGGAGG - Intronic
955545590 3:60025628-60025650 TGTCCAGCTGCCTTTGTTGGAGG - Intronic
959816769 3:110682765-110682787 TGACCACCAGCCTCTCATGGAGG - Intergenic
961706080 3:128786324-128786346 AGAACAGCAGTGTCTGTTGTAGG - Intronic
961713213 3:128842733-128842755 CCTCCAGCAGCCTCTGTTGGGGG - Intergenic
962766468 3:138568431-138568453 AGACCAGTGGTCTTTGTTGGGGG - Intronic
962844775 3:139264555-139264577 AGACCAGCAGACCATGCTGGAGG + Intronic
964466341 3:156997410-156997432 AGCCCAGCTGCTTCTTTTGGAGG - Intronic
984199566 4:176700795-176700817 AGACCAGCGGCTGTTGTTGGAGG - Intronic
984978685 4:185256258-185256280 ATTCCAGCAGCCTCAGTTGTAGG - Intronic
986486681 5:8245134-8245156 AGGCCAGCAGCCTCTGATCAGGG - Intergenic
990957847 5:61361657-61361679 TGGGCAGCAGCCTCAGTTGGAGG - Intronic
994870921 5:105350190-105350212 AGCCCAGTAGCCTCTCTGGGTGG - Intergenic
998497243 5:142601475-142601497 AGATCACCAGCTTCTGATGGGGG + Intronic
1000117011 5:158162719-158162741 AGAACAGCAACCTCTCTTGCTGG - Intergenic
1012291577 6:97461898-97461920 AGGACTGCAGCCTCTGTGGGAGG - Intergenic
1015347896 6:132180753-132180775 AGCCCAGCAGCTTCTCTGGGTGG + Intergenic
1015581090 6:134726158-134726180 AGACCAGCACTCGCTGTTGAGGG - Intergenic
1017439469 6:154450118-154450140 ACACCAGGAGCTTGTGTTGGAGG - Exonic
1018045587 6:159963371-159963393 ACACCCACAGCCTCTGGTGGAGG + Intergenic
1018314041 6:162539503-162539525 AGATCAGCAGCATCAGTTGGAGG + Intronic
1019657460 7:2203577-2203599 ACTCCAGCAGCCCCTGTTGATGG - Intronic
1020087951 7:5321514-5321536 AGACCAGCAGCCTCTGGGCCTGG + Intronic
1020128464 7:5546261-5546283 AGAGGAGGAGCCTCTGTTGAGGG + Intronic
1021185881 7:17564270-17564292 ACACCACCAGGGTCTGTTGGAGG + Intergenic
1022513817 7:30962958-30962980 AGCCCAGCAGCTTCTGTGAGTGG + Intronic
1025206347 7:56995588-56995610 AGACCAGCAGCCTCTGGGCCTGG - Intergenic
1025665588 7:63581339-63581361 AGACCAGCAGCCTCTGGGCCTGG + Intergenic
1027264385 7:76486032-76486054 AGGCCAGCAGGCTCTGTTAGTGG + Intronic
1027315755 7:76984146-76984168 AGGCCAGCAGGCTCTGTTAGTGG + Intergenic
1027620356 7:80477730-80477752 ATGCTAGCAGCTTCTGTTGGCGG + Intronic
1028742266 7:94289161-94289183 AAAACAGCATCCTCTGCTGGTGG - Intergenic
1029483099 7:100824611-100824633 ACACCAGCAGCCTCTGCTCGTGG - Intronic
1029633948 7:101771377-101771399 AGACCAGGGGGCTCTGTTCGTGG + Intergenic
1030059052 7:105608614-105608636 AGGCCGTCAGCCTCTGTTGATGG - Intronic
1030076149 7:105738784-105738806 AGACCCACAGCCTTTCTTGGAGG - Intronic
1030515318 7:110531288-110531310 ATACCTGCAGCCTTTGGTGGTGG - Intergenic
1034279959 7:149846352-149846374 AGAACAGCAGTGTCAGTTGGTGG - Intronic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1037597713 8:20368422-20368444 AGACCAGCATCCCCTATTGAAGG - Intergenic
1039582868 8:38681246-38681268 AGAACTGCAGCCTGTGTTGGTGG + Intergenic
1039593774 8:38772139-38772161 AGACCAGCAGTCCTTGGTGGTGG + Intronic
1039889371 8:41673784-41673806 AGAGCAGGTGCCTCTGTGGGTGG + Intronic
1039910453 8:41822777-41822799 TGACCAGCGGCCCCTGTTGGTGG - Intronic
1040640367 8:49327271-49327293 AGACCAACAGGCTCTGCTGATGG + Intergenic
1046449889 8:114374807-114374829 ATGACAGCAGCCTCTGGTGGGGG - Intergenic
1047209010 8:122825727-122825749 AGACCAGGAGTCTCTCTTTGAGG - Intronic
1047569086 8:126078355-126078377 AGACCATCAAACTCTATTGGGGG - Intergenic
1047746711 8:127850383-127850405 AGGCCACCAGCATCTGTTGGGGG + Intergenic
1049059867 8:140268281-140268303 TGAGCAGAAGCCTCTGGTGGTGG - Intronic
1057060456 9:91999363-91999385 AGGACAGCAGCCTCAGATGGAGG + Intergenic
1057214998 9:93223113-93223135 AGACCAGCAGAGAATGTTGGAGG + Intronic
1057978896 9:99638045-99638067 AGCCCAGCAGCCTCTGCTATGGG - Intergenic
1059430433 9:114246721-114246743 AGGCCTGCAACATCTGTTGGGGG + Intronic
1060243002 9:121920813-121920835 AGACGAGCAGCCTCCCTTGCAGG + Intronic
1061329978 9:129886120-129886142 AAACCAGCAGGCTCTGTTCTAGG + Intergenic
1061872073 9:133526467-133526489 GGCCCAGCAGCCTCTCTTGGAGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062609235 9:137366542-137366564 GGACCAGCAGCCTCCTCTGGAGG + Exonic
1185568548 X:1115046-1115068 AGACCAGAAGCCTCTGATCAAGG - Intergenic
1186370067 X:8937525-8937547 AGACCAGGAGATTCTCTTGGAGG - Intergenic
1188018392 X:25129686-25129708 AGAGCAGTAGCCTGTTTTGGTGG + Intergenic
1189009013 X:37027357-37027379 ACACCAGCAGACTGGGTTGGAGG - Intergenic
1191248949 X:58250124-58250146 CGACCAGAAGTCTCTGTTGTTGG - Intergenic
1192810365 X:74541949-74541971 AGAGCAGAGGCCTCTGTTTGGGG - Intergenic
1194897433 X:99461650-99461672 AAATCAGCAGCCTCTGTGGTTGG - Intergenic
1194953838 X:100156362-100156384 TGACCACCAGCCTCTCATGGAGG - Intergenic
1200215848 X:154367941-154367963 AGCCCAGGAGCCTCTGCTTGGGG + Exonic
1202378808 Y:24259488-24259510 AAGCCACCAGCCTCTATTGGGGG - Intergenic
1202491974 Y:25410633-25410655 AAGCCACCAGCCTCTATTGGGGG + Intergenic