ID: 954972531

View in Genome Browser
Species Human (GRCh38)
Location 3:54663358-54663380
Sequence TCCAGGGGCAGTGTGAGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954972523_954972531 5 Left 954972523 3:54663330-54663352 CCTCCTGTTGTCTTCAGCCCTTC 0: 1
1: 0
2: 5
3: 16
4: 261
Right 954972531 3:54663358-54663380 TCCAGGGGCAGTGTGAGCCGAGG 0: 1
1: 0
2: 4
3: 25
4: 210
954972524_954972531 2 Left 954972524 3:54663333-54663355 CCTGTTGTCTTCAGCCCTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 196
Right 954972531 3:54663358-54663380 TCCAGGGGCAGTGTGAGCCGAGG 0: 1
1: 0
2: 4
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954972531 Original CRISPR TCCAGGGGCAGTGTGAGCCG AGG Intronic
900096777 1:943001-943023 CCCAGGGGCAGTGTGGACCCTGG - Exonic
900137625 1:1125071-1125093 TTCAGGGGCGGTGGGAGCCCCGG + Intergenic
900556372 1:3282896-3282918 TGCAGGTGCAGTGAGAGGCGTGG + Intronic
901216066 1:7556046-7556068 TCAAGAGGCAGAGGGAGCCGGGG + Intronic
901843750 1:11969539-11969561 TCCAGGGCCAGAGTCAGCTGGGG - Intronic
901860332 1:12070209-12070231 TCCAGGGGAGGGGTGAGCAGAGG + Intronic
902737229 1:18409157-18409179 TCCCGGGGCTGTGTCAGCCCTGG - Intergenic
904496123 1:30887718-30887740 TCCAGAAGCAGTCTGAGCCCTGG - Intronic
905004078 1:34696308-34696330 GACTGGAGCAGTGTGAGCCGGGG - Intergenic
905312700 1:37061234-37061256 TCCAGGAGCAGAGAGAGCCCAGG - Intergenic
906516029 1:46439361-46439383 TACAGGGCCAGTGTGAGCTCAGG + Intergenic
906609119 1:47190023-47190045 TCCAGGGCCAGACTGAGCCCAGG - Exonic
907353770 1:53855269-53855291 TCCAGGGGCAGTGACAGGTGGGG - Intronic
911090360 1:94012644-94012666 TGCAGGGGCTGGGGGAGCCGTGG - Intronic
912381402 1:109249876-109249898 TCAGGGGGCAGTGGGAGCCCGGG + Intergenic
912515957 1:110216686-110216708 CCCATGGGCAGTGTCAGCCTGGG + Intronic
915599528 1:156913626-156913648 TCTAGAGGAAGTGTGAGCCGGGG + Intronic
916214478 1:162383738-162383760 GCCAGGGCCAGTGTGCGCAGTGG - Intronic
918322792 1:183380961-183380983 TCTAGAGGCAGTGTGAGGAGTGG + Intronic
918581569 1:186136932-186136954 TCCAGGGTGAGTGTGATCAGAGG + Exonic
920509927 1:206543356-206543378 CTAAGGGGCAGTGTGAGCAGTGG + Intronic
920695460 1:208178594-208178616 CCCAGGTGCAGTGTGAGATGGGG - Intronic
920701216 1:208219249-208219271 GCCAGGGGCAGTCTGGGCCAGGG + Intronic
924577274 1:245291951-245291973 TCCTGGGGCTGGGTGAGCCAAGG + Intronic
1063208693 10:3858642-3858664 TGCAGCTGCAGTGTGAGCCCAGG + Intergenic
1067238306 10:44469848-44469870 TCCAGGTGCAGGGTCAGCAGGGG + Intergenic
1067580654 10:47443534-47443556 TGCAGGGGCTGGGTGAGCTGGGG - Intergenic
1069799623 10:71074080-71074102 TCCAGGGGCAGAGTCTGCCTTGG + Intergenic
1071177486 10:82943328-82943350 TCAAGGAGCAGTGTGGTCCGTGG - Intronic
1071278846 10:84081326-84081348 TCTAGGGGCAGTGTGAGAAGAGG + Intergenic
1071568867 10:86685607-86685629 ACCAGGGGCAGTTTGAGCGCCGG - Intronic
1072619071 10:97067909-97067931 TCAAGGGGCGGTGTGCGGCGGGG - Intronic
1072740307 10:97905140-97905162 TCCAGTGGCAGTGTTAGGGGTGG - Intronic
1073477884 10:103766258-103766280 TCCAGGGCCAGTCTGAGCCCGGG + Intronic
1074051925 10:109888057-109888079 TCCAGGCCCAGTGTGAGGAGAGG + Exonic
1074302876 10:112248819-112248841 TCTAGCAGTAGTGTGAGCCGTGG - Intergenic
1075234074 10:120710802-120710824 CACAGGGGCAGTGGGAGCTGAGG - Intergenic
1075486355 10:122824510-122824532 TCCACAGGCAGTGTGAGCCATGG + Intergenic
1075922468 10:126224701-126224723 TCCAGGGCCAAGGTGAGCCAGGG - Intronic
1076859398 10:133133541-133133563 TGCAGGGGCAGCGTGTGCCCAGG + Intergenic
1077550146 11:3196604-3196626 CCCAGGGACAGTGGGAGCCACGG - Intergenic
1078543400 11:12229123-12229145 TCCCTGGGCTGTGTGAGCAGTGG + Intronic
1078823842 11:14907628-14907650 CCCAGGGGCAGTGGGAGCAGAGG - Intronic
1079122627 11:17696254-17696276 CCCAGGGGCAGTGGGGGCGGGGG + Intergenic
1084475426 11:69386087-69386109 TCCAGGGGCCTTCTGAGCCTCGG + Intergenic
1089759473 11:120712443-120712465 TCCAGAGGCAGTGTCAACAGAGG + Intronic
1090662333 11:128891140-128891162 GCCGGGGGCAGGGGGAGCCGGGG + Intergenic
1090872531 11:130761030-130761052 TCCAGAGGCAGTGAGAGCACGGG - Intergenic
1091357023 11:134945004-134945026 TCCACGGGCAGGGTGGGGCGGGG - Intergenic
1093529593 12:20145406-20145428 CCCATGGGCAGTGGCAGCCGTGG + Intergenic
1096563240 12:52451936-52451958 TCCAGGGGCAGTGGTGGCCTGGG - Exonic
1096565392 12:52473595-52473617 TCCAGGGGCAGTGGTGGCCTGGG - Exonic
1096567412 12:52493046-52493068 TCCAGGGGCAGTGGTGGCCTGGG - Exonic
1096815435 12:54198939-54198961 ACAAGGGGCAGTGGGAGCTGGGG - Intergenic
1097270165 12:57769184-57769206 GCCAGGGGCAGTCTGAACAGTGG - Intronic
1097883633 12:64707952-64707974 TGCAGGGGCAGTTTGAGACATGG - Intergenic
1101517024 12:105446324-105446346 TCCAGGGGCAATGTGAGTTCAGG + Intergenic
1103443248 12:120978848-120978870 TCCAGGCACTGGGTGAGCCGGGG + Exonic
1104144642 12:126020860-126020882 GCCAGGGGCTTTGTGAGCCATGG - Intergenic
1104751790 12:131244778-131244800 TCCAGGGGTGGAGTGAGCCCTGG + Intergenic
1104780103 12:131414297-131414319 TCCAGGGGTGGAGTGAGCCCTGG - Intergenic
1107437239 13:40390795-40390817 TCCAGGGGCTGTGTGTGCAACGG - Intergenic
1107835019 13:44406010-44406032 TCCAGGTGCAGTGAGGGGCGTGG - Intergenic
1112430543 13:99346727-99346749 TACAGGGGCAGAGAGAGCCCTGG - Intronic
1113557630 13:111251231-111251253 TCCAGGGGCTTTGGGAGCCAGGG + Intronic
1114073144 14:19131621-19131643 ACCAGGGGCAGTGTGCCCAGTGG - Intergenic
1114089122 14:19268362-19268384 ACCAGGGGCAGTGTGCCCAGTGG + Intergenic
1114459436 14:22877303-22877325 TCTAGGGGCAGTGAGGGCAGTGG - Exonic
1118346881 14:64947384-64947406 TCCAGGGGCAAGGAGAGCCCTGG - Exonic
1122140235 14:99659308-99659330 GCCAGGTGCAGGGTGAGCCTAGG - Intronic
1122290098 14:100676120-100676142 TCTCAGGCCAGTGTGAGCCGGGG - Intergenic
1122860862 14:104581850-104581872 TCCAGGGGCAGAGGGTCCCGGGG - Intronic
1123062953 14:105602390-105602412 TCCAGGGGCAGGATGGGCTGGGG - Intergenic
1124237832 15:28005048-28005070 CGCAGGGGCAGTGCGAGGCGAGG - Intronic
1125727702 15:41876581-41876603 TCCAGGGGAGGAGTGAGCAGAGG - Exonic
1126688937 15:51272788-51272810 ACCAGGGGCATTGTAAGCAGTGG - Intronic
1127849973 15:62903638-62903660 TCCAGGGGCAGCCAGAGCCCAGG - Intergenic
1129419022 15:75408120-75408142 TCCATAGGCAGTGTAAGCAGAGG - Intronic
1129534632 15:76302540-76302562 TCCAGGGGGAGTGGGGGCGGGGG + Intronic
1129678425 15:77644628-77644650 CCCAGGGGCAGGCTGAGCCCGGG + Intronic
1132781102 16:1626102-1626124 TCCGGCGGCAGTGGGAGTCGTGG + Exonic
1133237164 16:4392712-4392734 GCCAGGGCCGGTGTGAGCCGAGG - Intronic
1134066939 16:11234253-11234275 CCCAGGGGCAGAGTGAGATGGGG + Intergenic
1135398285 16:22147701-22147723 CCCAGGGGTAATGTGAACCGAGG - Intronic
1136043145 16:27596049-27596071 TCTGGGGGCAGTGGGAGCCAGGG + Intronic
1136246190 16:28977609-28977631 GACAGGGGCATTGTGAGCCATGG + Intronic
1138185090 16:54970780-54970802 TCCAGGAGCAGTTTGAGGGGTGG + Intergenic
1141989951 16:87603753-87603775 TCCAGGGGCAGAGCCAGGCGGGG + Intronic
1143199202 17:5100486-5100508 TCCAGGGGCAGGGTGAGAGTGGG - Intergenic
1143464155 17:7124481-7124503 GCCAGGTCCAGAGTGAGCCGAGG + Intergenic
1143496335 17:7314948-7314970 GCAAGCGGCAGGGTGAGCCGGGG - Exonic
1143891741 17:10107535-10107557 TCCAGTGGCAGGCTGAGCAGGGG + Intronic
1144473376 17:15563599-15563621 TCCAGGGGCGGGGCGAGCGGGGG + Exonic
1144673543 17:17146537-17146559 TGCAGTGGCAGTGTTAGCCCTGG + Intronic
1144833375 17:18143932-18143954 TCCAGGGGCAGTGTGACACGGGG - Exonic
1144923105 17:18781121-18781143 TCCAGGGGCGGGGCGAGCGGGGG - Exonic
1146656571 17:34638302-34638324 CCCAGAGTCAGTGTGAACCGGGG - Exonic
1147155097 17:38540632-38540654 TGCAGGGGCAGGGTGAGCTGAGG + Intronic
1147242107 17:39097199-39097221 GCCTGGGGCAGTGTGAGGAGGGG - Intronic
1147424484 17:40339472-40339494 TCCTGGGGCAGTGGGAGAAGTGG - Intronic
1150282735 17:63938772-63938794 TCCAGGGGCTGTGCCAGCCCAGG + Exonic
1151370843 17:73645224-73645246 TGCGGGGGCAGCGTGAGCCGGGG + Intergenic
1151731539 17:75914373-75914395 CCCAGGGGCAGGGTGGGCAGAGG - Intronic
1151880011 17:76889181-76889203 CGCAGGGGCAGTGTCAGCCCTGG + Intronic
1154130094 18:11729393-11729415 TCCAAGGGCAGAGGAAGCCGGGG - Intronic
1154298863 18:13175303-13175325 TCCATGGGCACTTTGAGCCCTGG + Intergenic
1155342000 18:24822489-24822511 CCCAGGGGCAGCTTGAGCCATGG + Intergenic
1157279788 18:46338873-46338895 GCGAGGAGCAGGGTGAGCCGGGG - Intronic
1161101548 19:2424371-2424393 GCCTGGGGCAGTGGGAGCCGGGG - Intronic
1162376993 19:10310653-10310675 GACACGGGCAGTGTTAGCCGAGG + Intronic
1162439404 19:10683307-10683329 TCCAGGGGCAGGGGGACCCCAGG - Intronic
1165044010 19:33090028-33090050 TCCAAGGGCCCTGTGAGCTGAGG - Intronic
1166699232 19:44872592-44872614 TCCAGGGGCAGTGTCAACCGGGG - Intronic
1167435021 19:49474337-49474359 TCCTGGGGCAGGGGGAGCAGAGG + Intronic
925730802 2:6918190-6918212 ACCAGGGGCAGTAGCAGCCGCGG - Intronic
926286681 2:11494207-11494229 TACAGGGGCAGTCTGATCCGGGG + Intergenic
928101280 2:28438902-28438924 TCCAAGGGCATTTTCAGCCGAGG - Intergenic
928370076 2:30734295-30734317 CCCAGGGTCAGTGTGAACTGGGG + Intronic
929885987 2:45879100-45879122 TGCAGGGGCAGGGTGGGCCAGGG - Intronic
929932593 2:46270610-46270632 GCCAGGGGCTGTGTGGGCTGGGG - Intergenic
931150199 2:59564715-59564737 TCCATGAGCAGTGTTGGCCGTGG + Intergenic
931435208 2:62239988-62240010 TGCATGGGCAGTGTGGGCCCAGG - Intergenic
932187858 2:69714200-69714222 TCCAGTGGCTGGGTGGGCCGGGG + Intronic
932307657 2:70715441-70715463 GCAAGGGACAGTGTGAGCCATGG + Intronic
933661588 2:84931835-84931857 TCAAGAGGCAGAGTGAGCCAGGG - Intergenic
933850339 2:86361498-86361520 TCAGGGGGCAGGGTGGGCCGAGG + Intergenic
934553956 2:95277784-95277806 ACCAGGGGCAGTAAGAGCCATGG + Intronic
935328573 2:101960122-101960144 TCCACTGGGAGTGTGAGCCTTGG + Intergenic
935641814 2:105298039-105298061 TGAAGGGGCAGCGTGAGCTGAGG - Intronic
937794372 2:125999472-125999494 GCGAGGGGCATTGTGAGTCGAGG + Intergenic
941721523 2:168817684-168817706 CCCTGGGCCAGAGTGAGCCGGGG + Intronic
942554775 2:177160568-177160590 TCTAGAGGCAGTGGGAGCCAGGG - Intergenic
943180237 2:184531001-184531023 GCCAGGGACAGTGTGAGGCCTGG - Intergenic
947948293 2:234125293-234125315 TCCAGGGGCAGGGTGGGGTGGGG + Intergenic
948610280 2:239162328-239162350 GCCAGGGGCAGGGTGGGCCTGGG - Intronic
948856184 2:240731755-240731777 TCCAGCGACAGTGTCAGCCAGGG - Intronic
948888258 2:240894475-240894497 TCCAGGGTGAGTCTGAGCCCAGG - Intronic
1171011023 20:21509545-21509567 TCCAGGGGCGGTGTGGAACGCGG + Intergenic
1171215779 20:23351026-23351048 TCCAGGGTCAGCGCGGGCCGCGG - Exonic
1171449652 20:25226565-25226587 TCCATGGACAGTGTGAGCCCCGG + Exonic
1172122683 20:32608071-32608093 GGCAGGGCCAGTGAGAGCCGTGG - Intronic
1172424224 20:34844639-34844661 TACTGGGACAGGGTGAGCCGAGG + Intergenic
1173192562 20:40887501-40887523 TCGAGGGGCAGAGGGAGCAGGGG - Intergenic
1175720064 20:61280426-61280448 GGCAGGGGCTGTGTGTGCCGCGG - Intronic
1177544220 21:22535408-22535430 TACAGGAGCATTGTGAGCCTAGG - Intergenic
1180491585 22:15853974-15853996 ACCAGGGGCAGTGTGCCCAGTGG - Intergenic
1180922142 22:19526343-19526365 TCCATGGGCAATGTGAGCCATGG - Intronic
1181597275 22:23924307-23924329 GCAAGGGGCAGTGTGGGCCTTGG - Intergenic
1181786276 22:25229595-25229617 TCCTGGGGCAGGGTGAGCCAGGG - Intronic
1181818447 22:25457418-25457440 TCCTGGGGCAGGGTGAGCCAGGG - Intergenic
1182021507 22:27085577-27085599 CCCAGGGACAGTGGGAGCCATGG - Intergenic
1182102342 22:27667136-27667158 TCCAGGCGGAGTGTGGGCCAGGG - Intergenic
1183722189 22:39568977-39568999 TACAGGGCCAGTCTGAGCCGTGG - Intergenic
1184177069 22:42794499-42794521 TCCAGGGGCAGTCAGAGGGGAGG - Intergenic
1184189339 22:42884608-42884630 TCCAGGGGCAGGGTGAGCCAAGG - Intronic
1184263237 22:43331849-43331871 CCCAGGGGCCGGATGAGCCGGGG + Intronic
1185153683 22:49180533-49180555 TCCAGGGGTTTTGTGAGCAGTGG - Intergenic
950026000 3:9820332-9820354 TCCTGGGACAGTGGGAGCCAAGG + Intronic
950181780 3:10918534-10918556 TCCAGGAGATGTGTGAGCCGAGG - Intronic
950435187 3:12975080-12975102 TTCAGGCGCAGTGTGAGGCTTGG + Intronic
952952090 3:38533415-38533437 CGCAGGGGCAGAGTGGGCCGAGG + Intronic
954369067 3:50160810-50160832 TCAAGGGGCAGGGTGGGACGAGG - Intronic
954371701 3:50172395-50172417 TCCAAGGGGAGGGAGAGCCGAGG - Intronic
954798114 3:53171871-53171893 TCCAGGGGCAGTGAGAGCCTAGG + Intronic
954972531 3:54663358-54663380 TCCAGGGGCAGTGTGAGCCGAGG + Intronic
955609560 3:60742738-60742760 CTCAGGGGCAGTCTGAGCTGAGG - Intronic
955878857 3:63522801-63522823 TCCAGGGGAGGTCTGAGCGGAGG + Intronic
961634229 3:128322754-128322776 CACAGGGGCAGTGAGAGCTGTGG + Intronic
961998525 3:131271118-131271140 TCCAGTTGCAGTGAGGGCCGAGG + Intronic
962748169 3:138413066-138413088 TCCAGGGGCAGCCTGAGCTGTGG + Intergenic
963307899 3:143674502-143674524 TCAAGGGGAAGTGTGAACCAGGG - Intronic
968310997 3:197682927-197682949 TGCAGGGACAGCATGAGCCGTGG - Intronic
968613954 4:1569046-1569068 TCCAGAGGCTGGGAGAGCCGTGG + Intergenic
969468362 4:7371025-7371047 TCCAGGGGCCCTGAGAGCCGGGG - Intronic
977162289 4:93650080-93650102 ACCAGAGGAAGTGTGAGCCTAGG - Intronic
978724567 4:111955529-111955551 TCCAGGAGCATTGTGAGCATGGG - Intergenic
981002414 4:139840494-139840516 CCCCGGTGCAGTGTGAGCAGCGG + Intronic
982069979 4:151686491-151686513 TCCCGGGGCAGGGGGAGCCCAGG - Intronic
982159974 4:152558651-152558673 ACCAGGGGCAGGATGAACCGTGG - Intergenic
982900917 4:161002528-161002550 TCCAGGTGCAGAGTGAGGAGGGG + Intergenic
984856325 4:184199166-184199188 TCCAGGGGCTGCTGGAGCCGAGG + Intronic
985120285 4:186633598-186633620 TCCACGGGCAATATGAGCGGTGG - Intronic
985488889 5:167564-167586 CCCAGGGCCATGGTGAGCCGGGG - Intronic
985722255 5:1495712-1495734 CCCAGTGGCCGAGTGAGCCGTGG - Intronic
989592171 5:43121663-43121685 TCCCGGGGCGGTGGGAGCCCCGG + Exonic
990260776 5:54020246-54020268 TACAGGAGCAGTGTCAGCGGAGG + Intronic
991054354 5:62306023-62306045 TCCAGCGGCTGGGTAAGCCGCGG + Intergenic
997964854 5:138348772-138348794 TCCAGGGAAACTGTGAGCCCAGG + Exonic
999151009 5:149426116-149426138 CTCAGGGGCAGTGGGAGCCGTGG + Intergenic
999749269 5:154614685-154614707 TCCAGGCGCTGTGTGATCTGTGG + Intergenic
1005882396 6:30071362-30071384 TGCGGGGGCCGTGTGGGCCGTGG - Exonic
1006427382 6:33974900-33974922 TTCAGGGGCAGTAGGAGCAGGGG - Intergenic
1006679507 6:35787155-35787177 TCCAGGGGAAGTGGGAGCCAGGG + Intronic
1007736117 6:43983315-43983337 TCCAGGGTCACTGTGAGCAGAGG - Intergenic
1011706133 6:90003242-90003264 CCCAGGAGCAGAGTGAGCCAAGG - Intronic
1014168554 6:118252839-118252861 TCAAGGGGAAGTGTGACCCCTGG + Intronic
1014230602 6:118897988-118898010 TGCAGGGGAAGTGAGAGCAGAGG - Intronic
1015724856 6:136289663-136289685 TCCAGGGGCAGTGAAGACCGAGG - Intronic
1015768076 6:136739920-136739942 TCCATGGGCAGTGGCAGCAGGGG + Intronic
1016426481 6:143941512-143941534 GCCATGGGCACTGTGAGCCTGGG - Exonic
1016713898 6:147203139-147203161 TCCAGGGCCGGTGTCAGCCCGGG - Intergenic
1017025447 6:150177053-150177075 ACCAGGGCCAGGCTGAGCCGTGG - Intronic
1017584345 6:155903948-155903970 TCCAGGGACAGAGTGATCTGGGG + Intergenic
1017730120 6:157307988-157308010 TGCAGGGGAAGTGTGAGAAGCGG - Intronic
1020071946 7:5233017-5233039 CCAAGGGGGAGTGTGGGCCGAGG - Exonic
1026898330 7:74023261-74023283 TCTTTGGCCAGTGTGAGCCGGGG - Intergenic
1027226468 7:76247053-76247075 TCCAGGGGCAGTGTGGACACAGG + Intronic
1030321961 7:108178808-108178830 TCCAGGGGCAGTGGTAGGGGAGG - Intronic
1030603744 7:111617113-111617135 TTCATGGGCAGTGTAAGCCCAGG + Intergenic
1031386995 7:121163454-121163476 TCCAGTGACAGTGGGAGTCGGGG - Intronic
1032084598 7:128877313-128877335 TGCAGGGGGAGTGGGAGGCGGGG + Intronic
1035832384 8:2710840-2710862 TCCTAGGGCAGTGTGGGGCGGGG - Intergenic
1036297036 8:7545671-7545693 TCAAGGGGCTGTGTTAGCCCTGG - Intergenic
1036325533 8:7775348-7775370 TCAAGGGGCTGTGTTAGCCCTGG + Intergenic
1036701490 8:11016358-11016380 CCCTGGGGGAGTGTGCGCCGCGG + Intronic
1037604107 8:20422963-20422985 TCCAGGAGCAGAGAGAGCTGAGG - Intergenic
1037822127 8:22140094-22140116 ACAAGGGGCAGGGTGAGCCAAGG + Intronic
1039908954 8:41809090-41809112 ACCTGGGGAAGTGTGAGCCCTGG - Intronic
1040635785 8:49271061-49271083 TCCAGTGGCAGTGTGTGCTAGGG + Intergenic
1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG + Intronic
1049738623 8:144223257-144223279 GCCAGGGGCAGCGTGGGCCTAGG - Intronic
1049814292 8:144591003-144591025 TCCAGGGTCAGTGCCAGCTGTGG - Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1050770462 9:9192057-9192079 TGCAGGGACAGTGTGAGACTGGG + Intronic
1052850255 9:33373841-33373863 CCCAGGGACAGAGTGAGCTGAGG - Intergenic
1054870818 9:70045664-70045686 GCCTGGGGCAGAGTGAGCTGTGG - Intronic
1056475673 9:86948741-86948763 TCCAGAAGCAGAGGGAGCCGGGG + Intergenic
1057314122 9:93958204-93958226 TCCAGGGGCTGAGAGAGCCAGGG + Intergenic
1057854686 9:98593509-98593531 TTCAGGGGCTGTGTGAGTCTGGG + Intronic
1059356317 9:113702080-113702102 TCCAGGAGCAGCGTGAGCCAAGG + Intergenic
1060074530 9:120579797-120579819 GCCAGGGGCAGTGTGTGGGGTGG - Intronic
1060311405 9:122465852-122465874 TTCAGGGGTAGTGGGAGCTGAGG - Intergenic
1061896738 9:133652225-133652247 TCCTGGGGCAGGCAGAGCCGAGG - Exonic
1062077535 9:134598977-134598999 TCCAGGGTCGGGGTGAGCCCGGG + Intergenic
1062265695 9:135685635-135685657 GCCAGGGGTAGGGTGAGCCGGGG + Intergenic
1062446858 9:136598819-136598841 GCCCGGGGCAGTGTGGGCAGCGG + Intergenic
1189309328 X:40008920-40008942 GCCCGGGGCAGCGGGAGCCGCGG - Intergenic
1195705777 X:107737159-107737181 TCCAGGGGCCCTGGGAGCCGTGG - Intronic
1198275227 X:135093520-135093542 TCCAGGGGCACTGGGAGCTCAGG + Intergenic
1201390274 Y:13490119-13490141 TTCAGAGGCAGTGGGAGCAGTGG + Intergenic