ID: 954972666

View in Genome Browser
Species Human (GRCh38)
Location 3:54664228-54664250
Sequence CACCACTGGCCTTGTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954972666_954972676 14 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972676 3:54664265-54664287 GTAAGGCCAGTAGTGGCCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 127
954972666_954972668 -9 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972668 3:54664242-54664264 CCAGTGGTGTCCCCGTGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 131
954972666_954972674 7 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972674 3:54664258-54664280 GCCATGGGTAAGGCCAGTAGTGG 0: 1
1: 0
2: 1
3: 12
4: 123
954972666_954972679 22 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972679 3:54664273-54664295 AGTAGTGGCCCTTGGACAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 99
954972666_954972669 -8 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972669 3:54664243-54664265 CAGTGGTGTCCCCGTGCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 72
954972666_954972678 21 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972678 3:54664272-54664294 CAGTAGTGGCCCTTGGACAGTGG 0: 1
1: 0
2: 0
3: 11
4: 159
954972666_954972670 -3 Left 954972666 3:54664228-54664250 CCTGCACAACAAGGCCAGTGGTG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 954972670 3:54664248-54664270 GTGTCCCCGTGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954972666 Original CRISPR CACCACTGGCCTTGTTGTGC AGG (reversed) Intronic
903507326 1:23846927-23846949 CACAACTTGCTGTGTTGTGCTGG + Intronic
904314139 1:29649467-29649489 CAAGACTGGCTTTGCTGTGCAGG + Intergenic
905528528 1:38657787-38657809 CAACACCGGGCTTGATGTGCTGG - Intergenic
905876152 1:41433163-41433185 CAGCACTGGCCTTGTTGGGTGGG - Intergenic
910553051 1:88498319-88498341 CTCCACTGTCCTTGGAGTGCTGG + Intergenic
915167355 1:153955722-153955744 CAACACTGGCCTTTTTTTTCTGG - Intronic
916209008 1:162343404-162343426 TACCACTGCCCTTGGTCTGCAGG + Intronic
919880461 1:201897439-201897461 CTCCACTGACCTGGTTGTCCAGG - Exonic
920597059 1:207282662-207282684 CACACCTGGCCTTGTTGGACAGG - Intergenic
922225258 1:223640486-223640508 CACCACCTGCCTTCTTGTCCAGG + Intronic
922718428 1:227888457-227888479 CACCACTAGGCTTGCAGTGCTGG + Intergenic
1066116244 10:32242941-32242963 CACCACTGGGCTCCTTGAGCTGG - Intergenic
1067753333 10:48985940-48985962 CCCCACTGGACCTGGTGTGCTGG - Intergenic
1068878672 10:62025778-62025800 CACCTCTGGCCTTGGTCAGCAGG - Intronic
1069726080 10:70579904-70579926 TTCCACTGGCCTTGGTGTGTTGG - Intergenic
1072789095 10:98304502-98304524 CACCTCTGGTTTTGTTGTCCAGG + Intergenic
1075417860 10:122278671-122278693 CTCCTCTGCCCCTGTTGTGCTGG - Intronic
1081965545 11:47166963-47166985 CACCAGTGGCCTTTTGGTGATGG + Intronic
1083936122 11:65871058-65871080 CACCAGTGGCCCTTTTGAGCTGG + Intronic
1084388994 11:68862638-68862660 CCGCACTGGCCTTGCTGTTCTGG - Intergenic
1090173617 11:124626739-124626761 CAACACTGACCTGGTTTTGCAGG - Intronic
1093383493 12:18522422-18522444 CACCACTAGCCCTGTTTTACAGG - Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1097216236 12:57415557-57415579 CACCCCTGGCCTTGTGATGTTGG - Intronic
1101883620 12:108642533-108642555 CGACACTGGCCGTGGTGTGCCGG - Intergenic
1104800112 12:131548802-131548824 CACCACTAGCCTTGTGCTTCTGG + Intergenic
1107772687 13:43805866-43805888 CACAACTGGCGCTGATGTGCAGG - Intergenic
1108126844 13:47253833-47253855 CACTACTTGCCTTGTTGGACAGG + Intergenic
1114292021 14:21296256-21296278 CACCACTGGCCGTGCTGCCCAGG + Intronic
1118224854 14:63889354-63889376 AACCACTGGCTCTGTTGTGGTGG + Intronic
1119435658 14:74596336-74596358 CCCCACCGGCCTTGTTCTTCTGG - Intronic
1119892910 14:78196453-78196475 CCCCACTGCCCTTCTTGTGCTGG + Intergenic
1120263603 14:82220201-82220223 CACCATTGGCCCTGGTGTTCAGG + Intergenic
1120280568 14:82432616-82432638 CACCACTGGCCAGTTTATGCTGG - Intergenic
1120821610 14:88916455-88916477 CACCACTGGCTTTTGTGAGCTGG + Intergenic
1121662725 14:95647487-95647509 CATCACTGTCTTTCTTGTGCAGG - Intergenic
1121681084 14:95793138-95793160 CACCACTGTGCATGTTGTACAGG - Intergenic
1122501942 14:102206679-102206701 CATCACTGGCCTTGTCAGGCAGG - Intronic
1124383568 15:29187871-29187893 CTCCACTGGTCTTGTTGCTCAGG + Intronic
1129157622 15:73728608-73728630 CACCAATGGCCCTGCTGTGAAGG - Intergenic
1131578597 15:93617636-93617658 CACCAGTGCCCTAATTGTGCAGG + Intergenic
1132555301 16:569613-569635 CACCACTGGCCTTGGGGATCTGG + Intronic
1132724274 16:1332155-1332177 CCCCACCGGCCTGGCTGTGCTGG + Intergenic
1133367932 16:5225860-5225882 CACCTCTGGCCTCCTTCTGCAGG + Intergenic
1134524777 16:14935138-14935160 GACCACTGCCCTTGTCCTGCAGG + Intronic
1134712366 16:16333625-16333647 GACCACTGCCCTTGTCCTGCAGG + Intergenic
1134954461 16:18375069-18375091 GACCACTGCCCTTGTCCTGCAGG - Intergenic
1135415248 16:22263940-22263962 CAAGACTGGCCTTGATGTGCAGG - Intronic
1135466659 16:22692457-22692479 CACCCTGGGCCATGTTGTGCTGG + Intergenic
1137596037 16:49724591-49724613 CAGCGCTTGCCTTTTTGTGCTGG - Intronic
1139305371 16:65981288-65981310 AACCACTTGCCTAGATGTGCTGG - Intergenic
1140213366 16:72988109-72988131 CTCGACTGGCCCTGTTGGGCGGG - Intronic
1141661948 16:85446214-85446236 CAGCAGAGGCCTTGTTGTCCTGG - Intergenic
1145959763 17:28880572-28880594 CACCAGTGGCCTTCTTGATCAGG + Exonic
1146458687 17:33026445-33026467 CACTACTAGCCTTGGTGTCCTGG - Intronic
1147375269 17:40019277-40019299 GACCACTGGGCTTGTGGTCCAGG + Exonic
1148244949 17:46024563-46024585 CACCTCTGGCCCTGTTGTGGGGG + Exonic
1149604849 17:57917224-57917246 AGCCACTGGCCTTGTTGCCCTGG - Intronic
1150513171 17:65777558-65777580 GATCACTGGCCTTGGTGTGTAGG - Intronic
1158006673 18:52680343-52680365 CATCACTGGCCTTCTTCTCCTGG - Intronic
1159543730 18:69814040-69814062 CACTCCTGGCCTTCTTCTGCTGG - Intronic
1159912334 18:74157992-74158014 AAGCACTGTCCTTGTTCTGCAGG + Exonic
1160742220 19:691974-691996 CCGCACTGGCCTGGTGGTGCTGG - Exonic
1163300250 19:16440991-16441013 CATCACTGGCCTTGCGGGGCAGG + Intronic
1166194191 19:41195417-41195439 CCCCACTGGCCTAGGTGCGCTGG - Intronic
1166666499 19:44683562-44683584 CCCCAATGGCCTTGTCCTGCTGG - Exonic
1167864492 19:52313490-52313512 CACCACTTGTCTTGTAGTGGTGG + Intronic
929867833 2:45733586-45733608 CAGCACTGGCCTCGTTGAGAGGG + Intronic
930617774 2:53611496-53611518 CACCACTGGCTTTTTTGAGGGGG - Intronic
932263282 2:70344812-70344834 CACAACTTGCCTTGTTTGGCGGG - Intergenic
932571185 2:72939195-72939217 CGCCTCTTGCCTTGGTGTGCTGG + Intergenic
935270800 2:101432749-101432771 CAGAGCTGGCCTTGTTGTGAAGG + Intronic
935398625 2:102637430-102637452 GATCACTGGCTTAGTTGTGCTGG - Intronic
938293261 2:130161499-130161521 CAGCCCTGGCCTGGTTGTGGAGG - Intronic
941675471 2:168339323-168339345 CCCCACTGGGCTTGTGCTGCAGG - Intergenic
944518788 2:200541674-200541696 CTCCACTGACATTGTTGGGCGGG + Intronic
945588906 2:211703643-211703665 CACCACTGTACGTGTAGTGCTGG - Intronic
946307806 2:218865974-218865996 CATCACTGGCTTTGATGTGGTGG + Intronic
947357841 2:229315730-229315752 GACCACTGGCCTTTCTGTCCTGG - Intergenic
1173545509 20:43894773-43894795 CAGCACTGGCCTGGGGGTGCTGG - Intergenic
1174413052 20:50348420-50348442 AATCACTGGCCTTGTTGGGGTGG - Intergenic
1174474176 20:50784158-50784180 CACCACCGGCTTGGCTGTGCAGG - Intergenic
1180077646 21:45471120-45471142 CACTACGGGCCTTGTGCTGCTGG + Intronic
1181021349 22:20105006-20105028 CCCCACTGGCCCTGTTCTGGAGG - Intronic
1181294855 22:21828812-21828834 CACCACCTGCTTAGTTGTGCAGG - Intronic
1182649639 22:31840760-31840782 CAGCACAGGCCTGGTTGTGATGG - Intronic
1184695026 22:46134211-46134233 CACCACTGGCCTGGTGATCCTGG + Intergenic
1185185266 22:49395519-49395541 CACCACTGTGCTGGCTGTGCTGG - Intergenic
951524467 3:23640390-23640412 CACCACTTGAGTTGTTTTGCTGG + Intergenic
952496716 3:33922409-33922431 CACCACGGGGCTTCTTGGGCTGG + Intergenic
954039268 3:47871914-47871936 CACCAGTGGGCTTCTTGGGCAGG + Exonic
954972666 3:54664228-54664250 CACCACTGGCCTTGTTGTGCAGG - Intronic
955752480 3:62196759-62196781 CACCACTGGCCTGGTTAACCTGG - Intronic
956734816 3:72230291-72230313 CATCACTGACCCTGTGGTGCTGG - Intergenic
956867601 3:73384855-73384877 CACCGCTGTCCTTCTCGTGCTGG + Exonic
959702926 3:109315429-109315451 CACCACTTGCCTTGGTGTTTTGG - Intronic
963314039 3:143739744-143739766 AACCACTGGTCTAGTTGTTCAGG - Intronic
968334729 3:197903435-197903457 CACCTCTGGCCTTGAAGTCCTGG - Intronic
968689727 4:1984277-1984299 GACCACTGGCCTTGTTCCTCTGG - Intronic
969070288 4:4531588-4531610 CCCCACTGGCCTTGTTACGCTGG + Intronic
970913307 4:21304434-21304456 CACCAGTGGCTTTGTTGGGCCGG + Intronic
972758166 4:42073010-42073032 CACCACTGGCCATGTTGGCCAGG + Intronic
972758175 4:42073063-42073085 CATCACTGGCCATGTTGGCCAGG + Intronic
977667623 4:99659151-99659173 CACCTCTGGCCTCTGTGTGCAGG - Intergenic
977928614 4:102728812-102728834 AACCACTGCCCTGGTGGTGCTGG + Intronic
982105448 4:152008051-152008073 CACCACTGGGCTGGTTCAGCTGG + Intergenic
982573069 4:157075061-157075083 CATCTCTGGCTTTGTTGTCCAGG - Intergenic
985546348 5:511125-511147 TCCCACTGGCCTTGCTGGGCAGG + Intronic
991346491 5:65673941-65673963 CACTATAGGCCTTGGTGTGCTGG - Intronic
996847745 5:127919460-127919482 CACCACTGCCATGGTTCTGCAGG + Intergenic
1001562290 5:172677594-172677616 AAACACTGGCCTTGGTGTGCTGG - Intronic
1002434798 5:179224621-179224643 CACCACTGGCCACCTTGGGCTGG - Intronic
1005828927 6:29655056-29655078 CACCACTGGCTTCATTTTGCTGG + Intergenic
1006467347 6:34203505-34203527 TCCCACTGGCCTTGGCGTGCGGG - Intergenic
1014891040 6:126846794-126846816 CACCATAGGCCTTGTTGTGCAGG - Intergenic
1015621446 6:135136180-135136202 CACCACTGCCGCTGGTGTGCTGG - Intergenic
1016881531 6:148916749-148916771 CACCACTTCCCAGGTTGTGCAGG + Intronic
1017047603 6:150362024-150362046 TTCCACTGGCCTTTTTGTGGGGG + Intergenic
1018454697 6:163941501-163941523 CAGCACTGGCCCTGTTCTCCCGG - Intergenic
1018651052 6:165991474-165991496 CACCAGTGCCCTTGTCGTGCTGG - Intergenic
1018696928 6:166397726-166397748 CCCCACTGGGCTGGTGGTGCGGG - Intergenic
1018919228 6:168159908-168159930 CACCACTGGCTTTGTCCTGGAGG - Intergenic
1020155473 7:5720115-5720137 CACCACTGCTTTTGTTCTGCTGG + Intronic
1021198268 7:17696687-17696709 CACCACTGGCCTTGTCTAGGAGG - Intergenic
1023659014 7:42454465-42454487 AACCAATGGCCTTGTTGCACAGG + Intergenic
1024358773 7:48445882-48445904 TACCACTTGCCTTGATATGCAGG - Intronic
1024849438 7:53693688-53693710 TACCACTTCCCTTGTAGTGCAGG - Intergenic
1025257588 7:57395690-57395712 AATCACTGGCCTTGTTGGGGTGG + Intergenic
1034881151 7:154763630-154763652 CCTCACTGGCCTTGTTTTTCTGG - Intronic
1035024375 7:155816382-155816404 CTCCACGGGGCTTGGTGTGCAGG - Intergenic
1035317254 7:158003786-158003808 TACCACTGGCCTTGGCGTGTTGG - Intronic
1042461046 8:69069188-69069210 CACCACGGGCCTTTTTATGCTGG + Intergenic
1051259530 9:15249371-15249393 CACCTCTGACCTTGCTGTGCTGG - Intronic
1051591899 9:18784677-18784699 CTCCACTGGCCTGGATGTGGTGG - Intronic
1051719822 9:20024976-20024998 CACCACTGGCCTGGTGGTCTAGG - Intergenic
1057303199 9:93898261-93898283 CACCTCAGGCCTTGTTGTGCTGG + Intergenic
1057913425 9:99037275-99037297 CACCACTGGCCTCATAGTGCTGG + Intronic
1190452738 X:50597233-50597255 CACCACTGGGCTTGGGGTGGAGG + Intronic