ID: 954973028

View in Genome Browser
Species Human (GRCh38)
Location 3:54667378-54667400
Sequence CCTCCAAGGCAGAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954973018_954973028 28 Left 954973018 3:54667327-54667349 CCTGCGGGCCAGTTTTGTTTTGT 0: 1
1: 0
2: 0
3: 19
4: 165
Right 954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG 0: 1
1: 0
2: 2
3: 56
4: 429
954973019_954973028 20 Left 954973019 3:54667335-54667357 CCAGTTTTGTTTTGTGCATGTTG 0: 1
1: 0
2: 2
3: 27
4: 445
Right 954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG 0: 1
1: 0
2: 2
3: 56
4: 429
954973021_954973028 -6 Left 954973021 3:54667361-54667383 CCATAATCTGTAACCACCCTCCA 0: 1
1: 0
2: 2
3: 13
4: 136
Right 954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG 0: 1
1: 0
2: 2
3: 56
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954973028 Original CRISPR CCTCCAAGGCAGAGGCTGGA AGG Intronic
900299940 1:1971941-1971963 GCGCCAAGGGAGAGGCTGGGTGG + Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
900394776 1:2448759-2448781 CCACCCAGGGAGAGACTGGATGG - Intronic
900478912 1:2888945-2888967 CCTCCAGGGCAGAGGACGGTGGG - Intergenic
900490469 1:2946334-2946356 CCCCCATGGATGAGGCTGGACGG + Intergenic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
902274005 1:15326205-15326227 ACTCCAAAGCAGAGCCTTGAAGG - Intronic
902289614 1:15427646-15427668 CCTCCTAGGCTGGGGCTGGTGGG - Intronic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
903556255 1:24195823-24195845 CCTCCACGCCAGGGCCTGGAGGG - Intergenic
903600280 1:24533157-24533179 CCACCGGGGGAGAGGCTGGAGGG - Exonic
903789405 1:25882269-25882291 CCTCCAGGGCTGATGCAGGAGGG - Intergenic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
904662526 1:32095846-32095868 CCTCCAGGACAGAGCCTGAAAGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905108016 1:35575427-35575449 CCTCCAAGGCCCTGCCTGGAAGG - Intronic
905797851 1:40825571-40825593 CCTCCAGGTCTGGGGCTGGAGGG + Intronic
905973989 1:42162503-42162525 CCACCAAGGCAGCGGGTGGTGGG - Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
910650789 1:89564679-89564701 GCTCAAAGGCTGAGGCAGGAAGG + Intronic
911043194 1:93608004-93608026 CTTCTGAGTCAGAGGCTGGATGG + Intronic
911191831 1:94956070-94956092 CCTCCAAGGGAGAAGCAGCAAGG + Intergenic
912553785 1:110501425-110501447 CCACCAAGGTACAGGCTGTAGGG - Intergenic
915305598 1:154975700-154975722 CCTCCAAGGCGGTGGCGGGGCGG - Intronic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
918458943 1:184755624-184755646 CTTCCGAATCAGAGGCTGGATGG - Intergenic
919781673 1:201225252-201225274 CCTCCAGGGCAGGGGCTGTGTGG - Intronic
920050610 1:203162511-203162533 CCCCCAATCCATAGGCTGGACGG + Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920440766 1:205979110-205979132 GCTCCTGGGAAGAGGCTGGAGGG - Intronic
921189450 1:212696905-212696927 CGTGCAAGGCAGAGGCTGTGTGG + Intronic
921584516 1:216931518-216931540 CCTCTAAGGCTGAGGCAGCAGGG - Intronic
922596086 1:226814342-226814364 CCATCAAGGCAGTGGCAGGATGG - Intergenic
923619657 1:235568066-235568088 CCAAAAAGGCAGGGGCTGGAAGG - Intronic
923834081 1:237590773-237590795 TCTCCAAGACGGTGGCTGGAGGG + Exonic
1063004235 10:1952899-1952921 CCGCCAAGGCGGTGGCTGCAGGG + Intergenic
1063392418 10:5659191-5659213 CCGCCAAGGGAGAGGGTGCAGGG - Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065695592 10:28376764-28376786 TTTCCAGGGCAGAGCCTGGAAGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066045372 10:31589875-31589897 GATCCAAGGTAAAGGCTGGAGGG + Intergenic
1066384820 10:34933183-34933205 CCGCCAAGTGAGAGGCTGGGAGG + Intergenic
1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG + Intronic
1069604585 10:69731497-69731519 CCTGCAAGGCCCAGGATGGAGGG - Intergenic
1069744430 10:70706165-70706187 CATCCAAGGCTGATGCTGGCTGG + Intronic
1070261740 10:74862849-74862871 ACTCCAAGGCAGTGGAGGGACGG + Intronic
1070804288 10:79261630-79261652 GCTCCAAGGCAGAGGGCTGAGGG + Intronic
1070904886 10:80063332-80063354 CCACCAAGGGACAGGATGGATGG - Intergenic
1071602332 10:86964454-86964476 AATCCACTGCAGAGGCTGGATGG - Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1071991312 10:91103138-91103160 GCCCCAAGGCAGAGGGTGGAGGG + Intergenic
1072041491 10:91611176-91611198 CCTCCATGGCAGGGGTGGGAAGG + Intergenic
1072195790 10:93116296-93116318 CCTCTGAGGAAGAGGCTGGCAGG - Intergenic
1072573297 10:96677088-96677110 CCTCCAAGCCAGAGTGAGGAAGG + Intronic
1073026501 10:100490722-100490744 GCTCAAAGGCAAAGGCTGGATGG + Exonic
1073179920 10:101577554-101577576 CCTCCAGGGCTGGGGGTGGAGGG - Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1074392787 10:113071870-113071892 CCTCCAGGTCAGGGGCTGGCTGG + Intronic
1074810540 10:117100635-117100657 CCTCAAAAGCACAGGCTGAAAGG + Intronic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1075095614 10:119468899-119468921 TACCCAAGGCAGAGCCTGGAAGG + Intergenic
1075679716 10:124323455-124323477 TCTGCAGGGCAGAGGCTGCAGGG - Intergenic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076212795 10:128662498-128662520 CCTCCAAAGCAGAGCCTGAGGGG + Intergenic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1076501686 10:130942149-130942171 CCTCCAAGGCATAGACAGGGCGG + Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077013875 11:391573-391595 CCTCCAGGGCAGAGCCTGCGTGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077184410 11:1229869-1229891 CACCCCAGGCAGAGGCTGGCGGG - Intronic
1077229108 11:1450692-1450714 CCTCCGACGCTGGGGCTGGACGG - Exonic
1077613753 11:3660667-3660689 TCTCCTGGTCAGAGGCTGGAAGG + Intronic
1078082084 11:8211434-8211456 CATCCAAGGCAGGGGAGGGAGGG + Intergenic
1078397401 11:10993251-10993273 GGTCCAAGGCAGAAGCTGCAAGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078556023 11:12326874-12326896 CCTCCAAGACAGAGGCTGTTGGG - Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079103059 11:17553300-17553322 GCACCAAGCCAGAGGCTGGTGGG - Intronic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080530719 11:33173195-33173217 CCTCCCAGACAGAAGCTGGGAGG + Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083160571 11:60851724-60851746 CTTCCAAGGCAGAAGCAGCAGGG - Exonic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083925542 11:65803936-65803958 CCTCCAAGGCCGAGGCGGTGAGG - Intergenic
1084323887 11:68388140-68388162 GCTCCATGGCAGTGGCTGAAGGG + Intronic
1084692353 11:70734681-70734703 CCTCCAGGGCACAGGCTGTGGGG - Intronic
1084955520 11:72689300-72689322 CCCCCAAGGAAGAGGCTGGTTGG + Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1086248251 11:84781900-84781922 GGTCTAAGACAGAGGCTGGATGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086723396 11:90149508-90149530 CCTCGGAGGCAGAGGTTGCAGGG - Intronic
1087137278 11:94733602-94733624 CATCTAAGGCAGAGGCCTGAGGG - Intronic
1087875007 11:103344491-103344513 GCTCCAAGGCAGAAGCTCAAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088594820 11:111433058-111433080 CCTCCAAGTCAGAGTCTGCCTGG - Intronic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1088885614 11:114004044-114004066 TGGCAAAGGCAGAGGCTGGAGGG + Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1092258655 12:6940872-6940894 GCACCGAGGCAGAGGCTGGAGGG - Exonic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1097357272 12:58615777-58615799 ACCCCAAGGCAGATGCTGCAGGG + Intronic
1099318453 12:81114361-81114383 CCTACAGGGCAGGGGTTGGAAGG - Intronic
1100790483 12:98124857-98124879 CCTCAAAAGCAGAGGCAGGTAGG + Intergenic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1103449557 12:121018792-121018814 CCTCGGAGGCAGAGGTTGCAGGG + Intergenic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1104915480 12:132262286-132262308 CAGCCATGACAGAGGCTGGAAGG + Intronic
1106669379 13:31888526-31888548 GCTCCAAGGCAGATGCTGGTGGG - Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107793110 13:44022554-44022576 CCAGCAGGGCACAGGCTGGAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108270232 13:48752053-48752075 GCACCAAGGCAGGGGCTGGAGGG - Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1112761175 13:102695149-102695171 GGTCCTAGGCAGAGGCTGGGTGG - Intergenic
1112962741 13:105147569-105147591 CCACCAAGGAGGAGGCTGGGAGG + Intergenic
1114199811 14:20509554-20509576 ACTCCTAAGCTGAGGCTGGAGGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116589651 14:46755336-46755358 CCTCCAAGGGGCAGGCTGGAGGG + Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118601185 14:67472442-67472464 CCTCCAATGCACAGGCAGGCTGG - Exonic
1120757158 14:88255164-88255186 ACTCCAAGGAAAAGGCTGGAGGG - Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121971616 14:98362335-98362357 CCTAGAAGGCAGAGGCCGGTGGG + Intergenic
1122118638 14:99540371-99540393 ACTCCCAGGCGGGGGCTGGAGGG + Intronic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1122925300 14:104896583-104896605 GTTCCCAGGCAAAGGCTGGAGGG - Exonic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1123694611 15:22869347-22869369 CCTCTAAGGCTGAGGTGGGATGG - Exonic
1124042990 15:26122004-26122026 CCTGCAAGGCAGAGGCATGGTGG - Intergenic
1125267900 15:37904768-37904790 CCTCCAGGACAGAGGAGGGAAGG - Intergenic
1126857140 15:52849508-52849530 CTTCCAAGGCACAGCCTGTATGG + Intergenic
1127023971 15:54782048-54782070 CCTCCGTTGCCGAGGCTGGACGG - Intergenic
1127103815 15:55592321-55592343 CTTACAAGGCAGAAGCTAGAAGG + Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1131480131 15:92773580-92773602 CATACAAGGCAGAAGCTGGGTGG - Intronic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1132508980 16:327419-327441 CCTCCTAGGCACAGGCCGCAGGG - Intronic
1132638023 16:962904-962926 CCTCCAAGGCAGTGGGAGCAGGG + Intronic
1132643612 16:988951-988973 CCTCCCAGGCAGCTGCTGGGAGG - Intergenic
1132661397 16:1063054-1063076 CCCACATGGCAGAGGCTGGCGGG - Intergenic
1133042663 16:3068785-3068807 CCTCCATGGCAGTGACAGGATGG - Intronic
1133053896 16:3135196-3135218 GCCCCGAGGCAGAGGCCGGAGGG + Exonic
1133142844 16:3760745-3760767 GCTCCAACGCCCAGGCTGGAGGG + Intronic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1133304666 16:4801664-4801686 CCTCCAAGTCAGCGGGGGGAAGG + Intronic
1133331730 16:4979040-4979062 TCTCCAAGTCAGATGCAGGAAGG + Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134045053 16:11094715-11094737 ACTACACGGCAGAGGCAGGAGGG - Intronic
1135207265 16:20493907-20493929 CCACCTTGGGAGAGGCTGGAAGG + Intergenic
1135211620 16:20529725-20529747 CCACCTTGGGAGAGGCTGGAAGG - Intergenic
1136911807 16:34149998-34150020 CCTCCAAGGCAGTGGAGGTAGGG - Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137760911 16:50939512-50939534 CATCCAAGGCAGAGGATGTGAGG - Intergenic
1138155841 16:54702189-54702211 CCTCCCAGGCAGAGGCCGTCAGG - Intergenic
1138269235 16:55682937-55682959 CCACCAAGGCAGAGTCAGGACGG + Intronic
1138433125 16:56982094-56982116 CCCACAAGGCAGATGCTGCACGG - Intronic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1140859200 16:79004569-79004591 CCTGCAAGCCAGAGGCCTGAAGG - Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141920047 16:87129577-87129599 CCTCCAAGTCAGAATCAGGAAGG - Intronic
1142247954 16:88978408-88978430 CCCCCAGGACTGAGGCTGGAGGG + Intergenic
1142252951 16:89001118-89001140 ACACCAGGGCAGAAGCTGGATGG - Intergenic
1203081001 16_KI270728v1_random:1146268-1146290 GGTCCAAGGCAGAGGGCGGATGG + Intergenic
1142588317 17:988160-988182 TGTCCAAGGAAGAGGCTGGAGGG + Intergenic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1146906806 17:36623157-36623179 GCTCCCCGGCAGAGGCTGCAGGG - Intergenic
1147240318 17:39086461-39086483 CCTCCAAGGAAGAGGAAGCAGGG + Intronic
1147365189 17:39954434-39954456 CCTCCAAGGAAAAGGCAAGAGGG + Intergenic
1147644392 17:42025147-42025169 CCTCCAAGAGCGAGGCTGGCGGG - Exonic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148901970 17:50885050-50885072 CCTCAAAGGTGGATGCTGGAGGG + Intergenic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152071062 17:78133785-78133807 GAGCCAAGGCTGAGGCTGGATGG + Intronic
1152170107 17:78740286-78740308 CCTTTAAGGCAGAGGCTGTGGGG - Intronic
1152307475 17:79529714-79529736 GCTCCAAGGCAGAGGAAGGAGGG + Intergenic
1152343517 17:79738071-79738093 CCCAGAAGGCAGAGGCGGGAGGG + Intronic
1152367626 17:79865794-79865816 CCTCCACGGAGAAGGCTGGAAGG + Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152884408 17:82840892-82840914 GCTGCAGGGCAGAGGCTGCAGGG + Intronic
1153579977 18:6562963-6562985 CCCAGAAGGCAGAGGCTGCAGGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155120764 18:22816616-22816638 CCCCCAAGGTACAGGCTGCAGGG + Intronic
1157239391 18:45995652-45995674 CCTCCAAGACAGCAGCTGCAGGG + Intronic
1157535338 18:48453356-48453378 CCTCCAAGGAAGAGGCTGACAGG - Intergenic
1157897151 18:51479999-51480021 AATCCATGTCAGAGGCTGGATGG + Intergenic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1158783867 18:60685353-60685375 GCCCCAAGGCAGGGGCAGGAAGG + Intergenic
1159014086 18:63087641-63087663 CCACCAAGGCATAGGCTCCAGGG - Intergenic
1159864653 18:73689966-73689988 CCTCCGAGGCTGTGGCTGCATGG - Intergenic
1160127851 18:76194634-76194656 CCTCCAAGACCGTGGCTGAAAGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1161277811 19:3428657-3428679 TCTCCAAGCCAGATGTTGGAGGG + Intronic
1161844155 19:6702289-6702311 ACCCCAAGGGACAGGCTGGAAGG + Intronic
1162306316 19:9876376-9876398 TCCCCCAGGCAGCGGCTGGAGGG + Intronic
1163118240 19:15200709-15200731 CCCCCAAGGCCGGGGCTGGCGGG - Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164400136 19:27896467-27896489 CCTCCAGGGTGGAGGGTGGAAGG + Intergenic
1164402229 19:27910160-27910182 CCTCCAAGGAGGACGCTGGCGGG + Intergenic
1164879459 19:31719282-31719304 CCTCCAAGCAATAGGCTGGGAGG + Intergenic
1165097230 19:33416298-33416320 CCTCCAAGTGCGAGGCAGGAGGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166399276 19:42466064-42466086 CCTCCATGGCAGAGCATGGCAGG - Intergenic
1166557582 19:43711133-43711155 CCTCGGAGGCGGAGGCTGCAGGG + Intergenic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168117842 19:54234152-54234174 CCTCCAGGGGCCAGGCTGGAGGG + Intronic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925461469 2:4067142-4067164 GCTCCAAGGCAGGGGCAGGGAGG + Intergenic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
932838687 2:75061178-75061200 ATTCCAGGGGAGAGGCTGGAGGG + Intronic
932909125 2:75787236-75787258 TCTCCAAGGAAGAGGATGCAAGG + Intergenic
933181659 2:79234363-79234385 CCTACAAGCCAGAGGATGGTGGG - Intronic
933357346 2:81228649-81228671 CCTCAGAGTCTGAGGCTGGAGGG + Intergenic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
933685831 2:85140481-85140503 CCTCCATGGTGGAAGCTGGAGGG + Intronic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
934077588 2:88441100-88441122 CGTGTAAGGCAGAGGCAGGAGGG + Intergenic
934708272 2:96499699-96499721 CCACTCAGGCAGCGGCTGGAGGG - Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935808314 2:106770660-106770682 CCTCCAGGGAAGATACTGGAGGG + Intergenic
936686936 2:114838419-114838441 ACTCCAAGGCTGAGGTGGGAGGG - Intronic
936904078 2:117516644-117516666 CCTCCATGGTACAGGCTGTATGG + Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937478049 2:122232477-122232499 CTTCCAAGGCACAGGATGGAGGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
941230985 2:162912501-162912523 CCTGCAAGTCAGAGGCTGCAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941732573 2:168934550-168934572 CCTCCTAGGCAGAGACAGCATGG - Intronic
943004324 2:182371081-182371103 CATCCAAAGCAGCAGCTGGATGG + Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947551480 2:231049812-231049834 CACCCAGGGCAGAGGCTGGGAGG - Intergenic
947565377 2:231190053-231190075 CCTCCAGGGAAGACCCTGGAAGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
948373110 2:237503261-237503283 CTGCCAAGGCAGGGCCTGGAGGG + Intronic
948563146 2:238867141-238867163 CCTCGAAGCCAGCAGCTGGAGGG + Intronic
948583385 2:239003296-239003318 GCTCCAAGGCACAGCCTGGGAGG - Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
948899672 2:240949927-240949949 CCCTCATGGAAGAGGCTGGAAGG + Intronic
948909195 2:240994520-240994542 CTTCCTGGCCAGAGGCTGGATGG - Intergenic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1171462980 20:25309292-25309314 TCCCCATGGCAGAGGCAGGAGGG - Intronic
1172010590 20:31843794-31843816 GCTGCAGGTCAGAGGCTGGAGGG + Intergenic
1172019379 20:31902223-31902245 GGCCCAAGACAGAGGCTGGAGGG - Intronic
1172270824 20:33654872-33654894 CAGACAAGGCAGAGGCTTGAGGG + Intergenic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174454061 20:50637295-50637317 CAGCCAGGGCAAAGGCTGGAGGG - Intronic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175634643 20:60570158-60570180 TCTCAAAGGCAAAGGTTGGAAGG + Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1175854406 20:62112674-62112696 TCTCCATGGCAGAGGCAGAAAGG + Intergenic
1176039628 20:63058528-63058550 CCCCCAAGGCAGGGGCTTGGGGG - Intergenic
1177828674 21:26112184-26112206 GCTCCAAGGCAGAGGCTTGGAGG + Intronic
1178283970 21:31309380-31309402 CCTCCAAGGCTGAGGTTGCAGGG + Intronic
1178733796 21:35130931-35130953 CCTCCAAGGGAGAGGCCCCAAGG - Intronic
1178809878 21:35871920-35871942 GGGCCAAGGCAGATGCTGGAGGG - Intronic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1180082683 21:45493928-45493950 GCCCCCAGGAAGAGGCTGGAGGG - Intronic
1181079592 22:20405245-20405267 CCACCAGGGCCAAGGCTGGAAGG - Intronic
1181509260 22:23381753-23381775 CCCCCACGGCAGGGGCTGCAGGG + Intergenic
1181634717 22:24169245-24169267 CCTCCAAGCCAGAGGGTAGGTGG + Intronic
1181666657 22:24403019-24403041 CCTCCAAGGGACTGGCTGGGTGG - Intronic
1181855343 22:25777531-25777553 CTCCCTAGGCAGTGGCTGGATGG + Intronic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1183443680 22:37838605-37838627 CCACCAAGACAGAGGGAGGAAGG + Intronic
1184002020 22:41682116-41682138 CCTCCAAGGCCGAGGTTAGGTGG - Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184330498 22:43824154-43824176 GCTCCCAGGCAGAGACTGGGAGG + Intergenic
1184979159 22:48084053-48084075 GCTCCTGGGCTGAGGCTGGAGGG - Intergenic
1185173006 22:49304384-49304406 CCAGCAAAGCACAGGCTGGAGGG + Intergenic
1185182822 22:49372932-49372954 CCTCCAGAGCAGAGGCTGTCTGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
950117876 3:10463193-10463215 ACCCCAAGGCAGTGGGTGGAGGG - Intronic
951582354 3:24179200-24179222 CCTCCAAGGGGGTGGCAGGAAGG + Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
952312024 3:32199019-32199041 CAGCCAGGGCTGAGGCTGGAGGG - Intergenic
953032849 3:39189352-39189374 CCTCCAGGGCTGGGGGTGGAGGG + Exonic
953328453 3:42032325-42032347 CTTCCCAGGCAGTGGCTGCAAGG + Intronic
953402793 3:42640993-42641015 ACTCCAAGGCAGAGGTGGGAAGG - Intronic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
954347565 3:50013134-50013156 CCTCAAAGGAAGAGTCTGGTGGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954988069 3:54813271-54813293 CCAGCAAGGCAGAGCCTGGTTGG + Intronic
955407841 3:58636517-58636539 CCCCCAGGGCAGATGCTGAATGG - Intronic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
959089687 3:101888769-101888791 CCTTCAAGGCAGAAGCAGAAGGG + Intergenic
960223326 3:115142894-115142916 CCTCCACGGCACAGGATGGGAGG + Intronic
961441994 3:126958758-126958780 CCTCCATCTCAGAGGATGGAAGG + Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
963300690 3:143593943-143593965 AATCCAAGGCAGAGGATGGCAGG - Intronic
964282402 3:155080325-155080347 TCCCCAAGGCAGAGGCCGCAGGG - Intronic
964681537 3:159345472-159345494 TCCCCAAGGCAGAGCCAGGAAGG + Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967690477 3:192467968-192467990 CCTCCTCGGCAGAGGATGAAAGG + Intronic
967877661 3:194277805-194277827 CCTCCACGGAAGAGTCTCGAGGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968572371 4:1348590-1348612 CCTCCAAGGAAAACGCCGGAGGG + Intronic
968628815 4:1639662-1639684 CTTGCAGGGCAGAGGCAGGAGGG + Intronic
968913702 4:3488086-3488108 CCTCCCAGGCACAGGCAGGGAGG + Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969591642 4:8125731-8125753 TTTCCATGGCAGAGGCTGGGCGG - Intronic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
973341837 4:49013214-49013236 CCTCCAAGGCGCAGCCTGGTTGG - Intronic
974425038 4:61731628-61731650 TCTCCAAGGCAGAAGTGGGAAGG - Intronic
974640717 4:64626270-64626292 TCTTCAAGACAGAGGATGGAGGG + Intergenic
976270403 4:83224721-83224743 ACCCCATGGCAGAGGGTGGAAGG - Intergenic
976826208 4:89263383-89263405 CCGCCAGTGCACAGGCTGGATGG - Intronic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
984654727 4:182305688-182305710 CATCCAAGGCCAAGGCAGGAAGG - Intronic
984681007 4:182608981-182609003 GCCCCAAGCAAGAGGCTGGAGGG + Intronic
984840122 4:184060387-184060409 CCCCCAGGGCTGAGCCTGGAAGG - Intergenic
985127966 4:186714139-186714161 CAGCCAGGGCAGAAGCTGGAGGG + Intronic
985527252 5:412752-412774 ACTCCATTGCATAGGCTGGAGGG + Intronic
985928517 5:3036108-3036130 CCTGCAAGGCGGAGGTGGGAGGG + Intergenic
986385187 5:7226385-7226407 CCACCCAGGCTGAAGCTGGAGGG - Intergenic
988485655 5:31666221-31666243 GCTCCAAGACTGAGGCTGGCTGG - Intronic
990861530 5:60333007-60333029 GCTCTAAGGCAGATGCAGGAAGG + Intronic
991621457 5:68549704-68549726 CCCCCACAGCAGAGGCTGGATGG + Intergenic
992136399 5:73750477-73750499 CCCCCAAGGAAGATTCTGGATGG - Intronic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
994402648 5:99300875-99300897 CTTCAAAGGCTGAGGCTGGGAGG - Intergenic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
996385001 5:122901699-122901721 CATCCAAGGGAGAGAATGGAGGG - Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997996467 5:138590725-138590747 CCCCGAAGGCTGAGGCAGGAGGG - Intergenic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
999301050 5:150490610-150490632 CCTCCAAGACAGAAGCTGTGAGG - Intronic
999314511 5:150575269-150575291 CCTCCATGGCAGGGCCAGGATGG - Intergenic
1000037809 5:157461996-157462018 ACTCCCAGGCAGTGCCTGGAAGG - Intronic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1001450892 5:171823472-171823494 TCTAGAAGGCAGAGGCTGTAAGG - Intergenic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1002899160 6:1396270-1396292 CCTCCAATTCAGAGCCTGGCTGG + Intergenic
1004053973 6:12115830-12115852 CCTCTGAGGCAGAGGCTCGCGGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1006171470 6:32095781-32095803 CCTCCAGGGCAGGCGCTGGCTGG + Intronic
1008571776 6:52823656-52823678 TCTCCATGGCCCAGGCTGGAGGG - Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015640612 6:135327732-135327754 CCTCCAGGGTAGAGGGGGGAAGG - Intronic
1017947044 6:159104341-159104363 CCTCCCAGGCATGGGCAGGAGGG - Intergenic
1018203103 6:161413235-161413257 CCTCCAGGGCACGGTCTGGAGGG + Intronic
1018802777 6:167236374-167236396 CCCCCAGGGCAGCGGGTGGAGGG + Intergenic
1019518549 7:1450328-1450350 CCACGAAGGGAGGGGCTGGAGGG + Intronic
1019526528 7:1482969-1482991 CCCCGAGGGCAGGGGCTGGATGG - Intronic
1019529189 7:1495170-1495192 CAACCAAGGCAGAGGCTCCACGG + Intronic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019672787 7:2291190-2291212 CTTCCAAAGCTGAGGCAGGAGGG + Intronic
1019849701 7:3542352-3542374 GCTACAAGGCACAGGCTGAAAGG - Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1021263574 7:18490710-18490732 CCTCCAAGGAATAGGATGGAGGG - Intronic
1021629830 7:22633766-22633788 CAGCCAAGGCAGAGGCTGGGAGG + Intergenic
1022168284 7:27795626-27795648 CCCAGAAGGCAGAGGCTGCAGGG - Intronic
1022507089 7:30914072-30914094 CATCCGAGGCAGAGGCGGGAGGG + Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1023093608 7:36638936-36638958 AGTCCAAGGAAGAGGCTGGGTGG - Intronic
1023922457 7:44640044-44640066 TCTCCAGGGCCTAGGCTGGAAGG + Intronic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1023977019 7:45038020-45038042 CCTCCATGCCAGAGGCTGCATGG + Intronic
1024903002 7:54343688-54343710 CCTCCAGGGCTGGGGCTGGACGG - Intergenic
1027560472 7:79722225-79722247 TCTCCAAGGGAGAGGGTGTATGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1028485016 7:91348156-91348178 TCTCAAAGGCAGAGGCAGGCTGG + Intergenic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1029535911 7:101157555-101157577 CTTCCAGGGCAGAGACTGGAGGG - Intronic
1029652573 7:101903438-101903460 CCTACAAGGCTGAGCCTGGCAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031377363 7:121043708-121043730 CCTACAAGGCAGTGACTGGCTGG - Intronic
1033072054 7:138212408-138212430 CCTTCAAGGCAGGGACTGGTGGG + Intergenic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1034489708 7:151386759-151386781 CCTCCGAGCCTGAGGCAGGAGGG - Intronic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035486798 7:159232487-159232509 CCACCCAGGGAGAGGCTTGACGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037142788 8:15538956-15538978 ATTCCAAGACTGAGGCTGGAAGG - Intronic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1040535572 8:48306493-48306515 CCTCCAAGACAAAGAGTGGACGG + Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1041197706 8:55417844-55417866 TCTGCAAGGCAGATGCTGAATGG + Intronic
1041500528 8:58534320-58534342 CCCCTAAGGCAGAGGCTGTTTGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1049222925 8:141436068-141436090 CCTGCAAGGCAGAGGCTCAGAGG + Intergenic
1049235846 8:141511888-141511910 CCCCGGAGGCAGAGGTTGGAGGG + Intergenic
1049258984 8:141628721-141628743 CCCCCAAAGCATGGGCTGGATGG - Intergenic
1049403493 8:142441348-142441370 GCTCCAAAGCAGAGGCTGTGTGG - Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1049747129 8:144267703-144267725 ACACGAAGGCAGAGGCTGGCAGG + Intronic
1051108099 9:13603720-13603742 CCACCAAAGCAGAGGCTGAAGGG - Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1055565044 9:77559797-77559819 CCTCCAAAGAAAAGGATGGAAGG - Intronic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1059251550 9:112891163-112891185 CCACCGGGGCAGGGGCTGGAAGG + Intergenic
1060424655 9:123494171-123494193 GCTCCAAAGATGAGGCTGGATGG + Intronic
1060941110 9:127543343-127543365 CGATCAAGACAGAGGCTGGAAGG + Intronic
1061954205 9:133953204-133953226 CCTCCAGGGCTGCTGCTGGAAGG + Intronic
1061973244 9:134055836-134055858 CCTCCAAGCATGAGGATGGACGG + Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062093435 9:134690476-134690498 CAGCCCAGGCAGATGCTGGAAGG - Intronic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1062312122 9:135944562-135944584 CCTCCATGGCACAGTCTGCAGGG - Intronic
1062568201 9:137172574-137172596 CCTCCAGGGCTGGGGCAGGAAGG + Intergenic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185775650 X:2800940-2800962 ACTCCATGGCCCAGGCTGGAAGG - Intronic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186066644 X:5773518-5773540 CCCCCAAGACAGTGTCTGGATGG + Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1187913441 X:24131734-24131756 GCTCTAAGGTGGAGGCTGGAAGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189967695 X:46391500-46391522 CCTGCAAGGGTCAGGCTGGATGG - Intergenic
1192260851 X:69505164-69505186 CCCCCGAGGTAGAGCCTGGACGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1192553327 X:72070681-72070703 CCACCAAGACAGAGGGAGGAGGG - Intergenic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1197263010 X:124336676-124336698 CCCCCAAGGCAGCTGCTGCAAGG + Intronic
1198104055 X:133445847-133445869 TCTCAAAGCCAGAGACTGGAAGG - Intergenic
1199654628 X:149982044-149982066 TCTGCATGGAAGAGGCTGGAAGG - Intergenic
1199970714 X:152858678-152858700 CCTACAAGCCACAGGTTGGAGGG + Intronic
1200984401 Y:9290525-9290547 CCTGCAAGGCCGAGGATGAAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202126040 Y:21569719-21569741 CCTGCAAGGCCGAGGATGAAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic