ID: 954973299

View in Genome Browser
Species Human (GRCh38)
Location 3:54670048-54670070
Sequence AGGTTTCCCCAGCTATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954973299_954973307 27 Left 954973299 3:54670048-54670070 CCATCATATAGCTGGGGAAACCT 0: 1
1: 0
2: 2
3: 7
4: 168
Right 954973307 3:54670098-54670120 AAATTCTGCTGTAGAGTTCATGG 0: 1
1: 0
2: 0
3: 23
4: 231
954973299_954973308 30 Left 954973299 3:54670048-54670070 CCATCATATAGCTGGGGAAACCT 0: 1
1: 0
2: 2
3: 7
4: 168
Right 954973308 3:54670101-54670123 TTCTGCTGTAGAGTTCATGGAGG 0: 1
1: 0
2: 1
3: 8
4: 146
954973299_954973300 -7 Left 954973299 3:54670048-54670070 CCATCATATAGCTGGGGAAACCT 0: 1
1: 0
2: 2
3: 7
4: 168
Right 954973300 3:54670064-54670086 GAAACCTTGCTCTCCCCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 157
954973299_954973302 1 Left 954973299 3:54670048-54670070 CCATCATATAGCTGGGGAAACCT 0: 1
1: 0
2: 2
3: 7
4: 168
Right 954973302 3:54670072-54670094 GCTCTCCCCCACAGGAAGCTTGG 0: 1
1: 0
2: 1
3: 25
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954973299 Original CRISPR AGGTTTCCCCAGCTATATGA TGG (reversed) Intronic
901860603 1:12072107-12072129 CGGTTTCCCCATCTATAAAATGG + Intronic
904344190 1:29857391-29857413 CAGTTTCCGCAGCTGTATGATGG + Intergenic
905030870 1:34883833-34883855 AGATTTCCCCAGCTATTTCTGGG - Intronic
906871602 1:49487891-49487913 AGGTTTCAACAACTAAATGAAGG + Intronic
908170142 1:61496236-61496258 TGGTTTCCCCATCTATAAAATGG + Intergenic
908375387 1:63532811-63532833 ATTTTTCCCCAGCTTTATTAAGG + Intronic
910353538 1:86327979-86328001 AGGTTTCCACATGTAAATGAAGG + Intergenic
910488987 1:87746912-87746934 AGATTTCCACAGCTTTATGTAGG - Intergenic
911724101 1:101223610-101223632 AAGTCTTCCCAGATATATGAGGG - Intergenic
912675149 1:111672984-111673006 AGGTTTCACCAGCTATCTGATGG - Intronic
915568416 1:156729792-156729814 GGGTTTCCTCAGCTATACAATGG + Intronic
916286466 1:163110490-163110512 AGGCCTCCCCAGCCATGTGAAGG - Intergenic
916896204 1:169164871-169164893 AGTTGTCACCAGCTATATGAGGG + Intronic
919157844 1:193789494-193789516 AGGTTTCCTCAGCTATCCCAAGG + Intergenic
919502664 1:198356706-198356728 AGGTTTCCCAAACCATATTAAGG - Intergenic
920772942 1:208906770-208906792 AGTTTTCCCCACCCCTATGATGG - Intergenic
922525089 1:226295554-226295576 AGGTTTGCACAGATATAAGAGGG - Intronic
924323763 1:242875078-242875100 AGGTGTCCCCTGCAATTTGAGGG - Intergenic
1066252105 10:33644334-33644356 ATGTTTCACCAGCTCTCTGATGG - Intergenic
1067024949 10:42836730-42836752 TGTTTCCCCCAGCTTTATGAAGG + Intergenic
1071260305 10:83913367-83913389 CTGTTTCCCCATCTATAAGATGG + Intergenic
1081930459 11:46867266-46867288 AGGTTTCCCCAGAGATATGATGG - Intronic
1085715692 11:78871214-78871236 CTGTTTCCCCATCTATAAGACGG + Intronic
1087372155 11:97298688-97298710 AGGTTTCCCTAGTGATATGCTGG + Intergenic
1089706305 11:120280486-120280508 CAGTTTCCCCAGCTTTATAATGG - Intronic
1090593070 11:128292946-128292968 AGGCTTCACCAGCAAAATGAGGG - Intergenic
1091661647 12:2388450-2388472 ATTTTTCCCCAGCTTTATTAAGG - Intronic
1098410646 12:70179848-70179870 AAGTTTCCTCATCTATAAGAAGG + Intergenic
1102228983 12:111249263-111249285 ACGTTTCCCCACCTCTCTGAAGG + Intronic
1103593288 12:122007397-122007419 AGGTTTGCCCAGCCTGATGAGGG - Intergenic
1105665556 13:22552238-22552260 ATCTTTCCCCAGGTACATGATGG - Intergenic
1106481068 13:30137128-30137150 AGGCTTCCCCATCTGTATAATGG + Intergenic
1108440448 13:50447688-50447710 TGGTTTCCTCATCTATAAGATGG + Intronic
1108620470 13:52178219-52178241 AGCTTTCCCCACCTATAAAATGG - Intergenic
1109663523 13:65497556-65497578 AGTTTTCCTCAGCAAAATGAAGG + Intergenic
1111946161 13:94668003-94668025 TGGTTTCCCCAGATAACTGATGG - Intergenic
1112431482 13:99354424-99354446 GGGTTTCCCCAGCTGTAAAATGG - Intronic
1112712916 13:102151080-102151102 ATTTTTCCCCAGCTATCTGGTGG + Intronic
1112866214 13:103902824-103902846 AGGTTTCCCTAGCTGTAAAAAGG + Intergenic
1117382175 14:55175247-55175269 AGTTTTCCCCCACTATATTAAGG + Intronic
1120255250 14:82110604-82110626 AGGTTTCCCCAGAGACATGCTGG + Intergenic
1124156644 15:27231795-27231817 ATTTTTCCACAGTTATATGAAGG + Intronic
1125410151 15:39397714-39397736 AGGTATCCCCAGCTCTCAGAGGG + Intergenic
1127539612 15:59923754-59923776 CGGTTTCCTCAGCTATAAAATGG + Intergenic
1128751500 15:70153471-70153493 CGGTTTCCTCATCTATAAGATGG - Intergenic
1130255137 15:82322480-82322502 CGGTTTCCCCATCTTTAAGATGG + Intergenic
1130599837 15:85267526-85267548 CGGTTTCCCCATCTTTAAGATGG - Intergenic
1137280897 16:46975538-46975560 AGGTTTCCTCAGGTGTAAGATGG + Intergenic
1138136930 16:54531377-54531399 AGTTTTCCCCATCTGTATAATGG + Intergenic
1138457106 16:57127466-57127488 AGTTTTCCCCAGCTATGAGCAGG + Intronic
1140408700 16:74728112-74728134 CAGTTTCCCCAGCTATAAAATGG + Intronic
1141431524 16:83972664-83972686 AGGGTTGCCCAGCTGCATGAAGG + Intronic
1141750921 16:85957354-85957376 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1144593941 17:16549773-16549795 AGTTTTCCTGAGCTAAATGAGGG - Intergenic
1144810456 17:17995500-17995522 ATGTTTCCCCAACTATAAAATGG - Intronic
1147250226 17:39148871-39148893 AGGTTTCCCCGTCTATAAAATGG - Intronic
1150888669 17:69118763-69118785 AGGGTTCTCCATGTATATGATGG + Intronic
1156213602 18:34974910-34974932 AGATTTTCCCAGGTATATAATGG - Intergenic
1156577818 18:38338965-38338987 AGGATTCCTCAGCTATTTGAGGG + Intergenic
1160750415 19:731439-731461 CGGTTTCCCCATCTGTAAGATGG + Intronic
1160879026 19:1311196-1311218 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1162806160 19:13138945-13138967 CTGTTTCCCCAGCTATAAAATGG - Exonic
1165527439 19:36368136-36368158 ACTTTTCCCCAGTTATATGTGGG - Intronic
1165826300 19:38707852-38707874 CGGTTTCCACATCTGTATGATGG - Intronic
1166082940 19:40456298-40456320 CTGTTGCCCCAGCTATTTGAGGG + Intronic
1166530157 19:43537707-43537729 AGGATTCTCCAACTTTATGATGG + Intergenic
926275212 2:11398369-11398391 AGGGTTGCTCAGCTATTTGAAGG - Intergenic
928012377 2:27621829-27621851 TGGTTTCACAAGCTAGATGATGG - Exonic
929711164 2:44268001-44268023 ACATTTCCCCAGCTGTAAGATGG + Intergenic
934038652 2:88109698-88109720 AGGTTTCCTCATCTATAAAATGG + Intronic
934844248 2:97652021-97652043 AGGCTTCCCCATCTCTATTATGG - Intergenic
946421240 2:219566127-219566149 CTGTTTCCCCAGCTATAAAATGG + Intronic
946497741 2:220213018-220213040 TGGTTTCTCCAGCTAAATGTGGG + Intergenic
947398015 2:229705679-229705701 AGGTTTCCTTAGCCATAAGATGG + Intronic
948648860 2:239426394-239426416 AGGTTTGGCCAGCTCCATGAAGG - Intergenic
1170737365 20:19023523-19023545 TGGTTTGCCCAGCTCTATAATGG - Intergenic
1172275980 20:33679642-33679664 CCGTTTCCCCAGCTATAAGATGG + Intronic
1172550157 20:35792880-35792902 CTGTTTGCCCAGCTATAAGATGG - Intronic
1174198621 20:48791391-48791413 TGGTTTCCCCAGCTATGAAACGG - Intronic
1174528880 20:51195280-51195302 AAGTGTTCCCAGCTCTATGAAGG - Intergenic
1174539911 20:51281126-51281148 ATGTTTTCCCAGCTATATCTAGG - Intergenic
1174839912 20:53892099-53892121 CGGTTTCCCCATCTATAATAGGG - Intergenic
1175215047 20:57387828-57387850 CAGTTTCCTCAGCTATATAATGG + Intergenic
1178128213 21:29539792-29539814 AAATTTCCCCATCTATATAAAGG - Intronic
1181735845 22:24880879-24880901 AGTTTACCCCATCTATAAGATGG + Intronic
1181740744 22:24919611-24919633 AGTTTTCCCCATCTGTAGGATGG - Intronic
1181994398 22:26863975-26863997 CAGTTTTCCCAGCTATATAAGGG - Intergenic
1182356138 22:29723029-29723051 TGGTTTCCCCACCTATAAAAGGG + Intronic
1183000531 22:34855083-34855105 AGGTTTCCTCATCTATACAATGG + Intergenic
1184087355 22:42272838-42272860 TGGTTTCCTCAGCTATAAAATGG + Intronic
1184409078 22:44316293-44316315 CAGTTTCCCCAGCTATCTAATGG + Intergenic
1184512737 22:44942844-44942866 GAGTTTCCCCATCTTTATGATGG + Intronic
950119139 3:10470307-10470329 CAGTTTCCCCATCTATATAATGG - Intronic
950254014 3:11489169-11489191 AGATTTTCCCAGCTGTATGCTGG + Intronic
950662396 3:14474621-14474643 CAGTTTCCTCAGCTATAAGAAGG - Intronic
951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG + Intronic
952917169 3:38255651-38255673 CAGTTTCCCCAACTATATAATGG - Intergenic
952995323 3:38875062-38875084 AGGTTTCCTCATCTATAATATGG - Intronic
954973299 3:54670048-54670070 AGGTTTCCCCAGCTATATGATGG - Intronic
955530706 3:59870040-59870062 CAGTTTCCCCAGCTATACAATGG - Intronic
956750397 3:72340195-72340217 CTGTTTCCCCAGCTATAAAATGG - Intergenic
956759573 3:72427770-72427792 AGGTTTACTCAGTTATATGGAGG + Intronic
957421583 3:79978559-79978581 ACGTTTCACCAGCTATCTAAGGG + Intergenic
957811204 3:85225116-85225138 AGTTTTCCCCAATTCTATGAAGG + Intronic
960624188 3:119664429-119664451 GGTTTTCCCCAGCTAGAGGAGGG + Intronic
965221106 3:165926683-165926705 ATGTTTAGCCAGCTATATGCTGG - Intergenic
966264146 3:178017420-178017442 AGTTTTCCTCATCTATAAGATGG + Intergenic
966659982 3:182403472-182403494 AGGTTTCCTCATCTGTTTGATGG + Intergenic
966709529 3:182956518-182956540 GAGTTTCCTCATCTATATGATGG + Intronic
966923654 3:184630538-184630560 GAGTTTCCTCATCTATATGAAGG - Intronic
967448671 3:189597214-189597236 AGGTTTCCCCACCTTTGTGAAGG - Intergenic
969011055 4:4063087-4063109 AGGCTTCCTCAGCTATGTGGAGG - Intergenic
969598476 4:8162023-8162045 ACCTTTCCCCTGCTCTATGATGG + Intergenic
970164284 4:13219899-13219921 AGGTGTCCTCACCTATAAGATGG + Intergenic
977741486 4:100489059-100489081 AGGTTTCTCCATCTATAAAATGG - Intronic
977890791 4:102308881-102308903 TGGTTTCCCCAACTGTATGAAGG - Intronic
979455709 4:120923138-120923160 AGGATGCCCCAGCTGTGTGAAGG - Intergenic
983571956 4:169218712-169218734 AGCTTTCACCAGCTATAAAAAGG - Intronic
984882308 4:184420807-184420829 TGGTTTCCTCAGCTATAAAATGG - Intronic
985135659 4:186783572-186783594 AGGTTTCCCCTGATATATCAAGG + Intergenic
986321493 5:6635517-6635539 AGGTTTCCCCACCTGTAGAATGG + Intronic
988471179 5:31540316-31540338 AGGTGTACCCACCTATATAATGG + Intronic
988698954 5:33653685-33653707 AGGATACCCCATCTATAGGAGGG - Intronic
989417258 5:41194300-41194322 CGGTTTCCTCATCTATATGTTGG - Intronic
990335193 5:54765425-54765447 TGGTTTTCCCAGCTTTCTGATGG - Intergenic
990725350 5:58747304-58747326 AAGTTTCCCATGCTATATGTGGG + Intronic
990834812 5:60005637-60005659 TTGTTTCCCCAGCTTTATTAAGG - Intronic
993943048 5:94084746-94084768 TGTTTTCCCCAGTGATATGATGG - Intronic
994380950 5:99070711-99070733 AGGTTTCCTTATCTGTATGATGG + Intergenic
996645259 5:125806897-125806919 ATGTTTCCCCTGCTATATCTAGG - Intergenic
997297887 5:132779350-132779372 AGCATTCCCCAGTTATTTGACGG - Intronic
997420891 5:133765957-133765979 AAGTTTCCCCACCCAGATGATGG + Intergenic
998698293 5:144666576-144666598 AGCTTTCCCCAGGTAAGTGAAGG + Intergenic
998764557 5:145471188-145471210 ACTTTTCACCAGCTATATGGAGG + Intergenic
1001484432 5:172109825-172109847 GGGTGTCCCCTGCTAGATGATGG + Intronic
1001799830 5:174533337-174533359 AGATTTCTCCAGCTATCAGATGG + Intergenic
1002011798 5:176289172-176289194 TAGTTTCCCCATCTGTATGATGG + Intronic
1002296325 5:178233082-178233104 AGGTTTTCCCAGCCCCATGAAGG + Intergenic
1002778312 6:347661-347683 GAGTTTTCTCAGCTATATGAGGG - Intronic
1003313258 6:4987442-4987464 AGGTTGCCCCAGCTAGAGCAGGG + Intergenic
1007313712 6:40967258-40967280 ATGTTTCCCCACCTATATAATGG - Intergenic
1016491910 6:144614513-144614535 AGGTTTTCTCAGATATGTGATGG + Intronic
1017482460 6:154871300-154871322 TGTTTCCCCCAGCTATATTAGGG + Intronic
1019415132 7:923603-923625 CAGTTTGCCCAGCTATAAGAGGG - Intronic
1023016978 7:35978349-35978371 ATGTTTCCTCAGCTATAAAATGG + Intergenic
1024149107 7:46551295-46551317 AATTTTCCCCAGCTTTATTAAGG - Intergenic
1024604269 7:51011710-51011732 AGGTCTCTGCATCTATATGAAGG + Intergenic
1026457601 7:70586306-70586328 ATATTTCTCCAGCTATATGGTGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029538384 7:101169023-101169045 AGGATTCCCCAGCTCTGGGATGG - Intergenic
1031857434 7:126939416-126939438 AGGTTTCCTCATCTATAACATGG + Intronic
1032484691 7:132276579-132276601 AGGTTTCCCCAGAAATCTGCAGG + Intronic
1034311613 7:150093835-150093857 AGATTTCCTCACCTATATGTGGG + Intergenic
1034795237 7:154006819-154006841 AGATTTCCTCACCTATATGTGGG - Intronic
1037082176 8:14800716-14800738 AGGCCTCCCCAGCCATATGGAGG + Intronic
1039331211 8:36538932-36538954 AAGTTTCCCCAGCTGGATTAAGG + Intergenic
1040980049 8:53237820-53237842 AAATTTCTTCAGCTATATGAGGG - Intronic
1041979162 8:63835951-63835973 AGTTTTCTCCAGATGTATGATGG - Intergenic
1046068658 8:109224144-109224166 AAGTTTCCTCAGGTATATAATGG - Intergenic
1047317449 8:123747700-123747722 AGGTTGCCCCAGCTATAAATAGG + Intergenic
1048176306 8:132155560-132155582 CAGTTTCCTCATCTATATGATGG - Intronic
1051000547 9:12276908-12276930 TGTTTTCTCCAGCTCTATGATGG + Intergenic
1053320567 9:37094863-37094885 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1057894829 9:98900746-98900768 CTGTTTCCCCAGCTATAAAATGG - Intergenic
1059687374 9:116650475-116650497 AGGTTTCCTCAGCTGTAAAAGGG + Intronic
1059920910 9:119158764-119158786 TGGTTTCCTCACCTGTATGATGG + Intronic
1060521762 9:124298114-124298136 CGGTTTCCCCATCTATAAAATGG + Intronic
1060813080 9:126620791-126620813 AGCTTTTCCAAGCTATATGGAGG - Intronic
1185666788 X:1771935-1771957 TGGTTTCCCCAGCTGTAAAATGG - Intergenic
1186814735 X:13225351-13225373 TGCTATCCCCAGCTATAGGAAGG + Intergenic
1187450649 X:19393242-19393264 TGGTTTCCCCATCTATAAAAGGG + Intronic
1189725096 X:43960236-43960258 AGGCTTCCCCAGCTAATTAATGG - Intronic
1192433257 X:71126576-71126598 CAGTTTCCCAAGCTATTTGAAGG + Intronic
1193654171 X:84178375-84178397 AGGTTTCCTCATCTATAAAAGGG + Intronic
1196129877 X:112143874-112143896 ATGTTTCCCCAGTTTTATTAAGG + Intergenic
1197864131 X:131000034-131000056 TGTTTTCCCCAGCTATACAATGG - Intergenic
1198850165 X:140957865-140957887 AGGTTTCCTCAGGTATCTGTGGG + Intergenic
1199573938 X:149294804-149294826 CAGTTTCCCCAGCTATAAAATGG - Intergenic