ID: 954976577

View in Genome Browser
Species Human (GRCh38)
Location 3:54700945-54700967
Sequence AATATGCTGGGACTCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954976577_954976582 20 Left 954976577 3:54700945-54700967 CCCTCTGAGAGTCCCAGCATATT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 954976582 3:54700988-54701010 AGTAATTATTCTAAAAGCACAGG 0: 1
1: 0
2: 2
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954976577 Original CRISPR AATATGCTGGGACTCTCAGA GGG (reversed) Intronic
902129634 1:14248466-14248488 AATATGGTGAGACTAGCAGAGGG + Intergenic
905892233 1:41524663-41524685 TCTGTGCTGGGACTCCCAGAGGG + Intronic
906162859 1:43663605-43663627 AAAATGCTGAGACTCAAAGATGG - Intronic
907105057 1:51875352-51875374 AATAAGCTGAGACACTAAGAAGG + Intronic
907183009 1:52587327-52587349 AATAGACTGGTACTCACAGATGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
910826050 1:91408366-91408388 GATATGATGGGATTCTCAGGAGG + Intergenic
912980199 1:114364499-114364521 AATGTGCTGGAACTCTAAAAGGG - Intergenic
913657769 1:120977594-120977616 AATATGAAGTCACTCTCAGATGG + Intergenic
914009119 1:143760678-143760700 AATATGAAGTCACTCTCAGATGG + Intergenic
914522336 1:148428867-148428889 AATATGAAGTCACTCTCAGACGG + Intergenic
914647750 1:149669330-149669352 AATATGAAGTCACTCTCAGATGG + Intergenic
916473058 1:165142462-165142484 AATATGATGGTCCTCTCAGGAGG + Intergenic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
919491890 1:198214042-198214064 AAGATGCTGGCTTTCTCAGATGG - Intronic
919797338 1:201329066-201329088 AATGTCCTGGGAGTTTCAGAGGG + Intronic
919922300 1:202173956-202173978 AATCTTCTAGGACTCACAGAAGG + Intergenic
922194911 1:223351544-223351566 AACCTCCTGTGACTCTCAGATGG - Intronic
922547808 1:226471619-226471641 AATGTGCTGGGAATCCCACAGGG + Intergenic
1064367940 10:14725142-14725164 GAAAAGCTGAGACTCTCAGACGG + Intronic
1064550079 10:16491741-16491763 AGAATGCTGGGACTCTCCAATGG + Intronic
1071138080 10:82474900-82474922 AATATGCTGATAATCTTAGAAGG - Intronic
1073864840 10:107790161-107790183 TATATGCTATGACTATCAGATGG + Intergenic
1074977508 10:118593672-118593694 AATATCATGGTACTCTCAGCTGG + Exonic
1075286209 10:121188429-121188451 AATAACCTGGGGCTCTCTGATGG + Intergenic
1078034837 11:7792819-7792841 TATATCCTGAGAATCTCAGAAGG - Intergenic
1079257629 11:18846233-18846255 AATATGCTGCAAATATCAGAAGG + Intergenic
1081035423 11:38138135-38138157 CATATTATGGGAATCTCAGAAGG + Intergenic
1085240002 11:75045257-75045279 AATGTGCTGGAACTCTAAGAAGG + Intergenic
1087917890 11:103831439-103831461 AATCTGCTGGAGCTCTTAGATGG - Intergenic
1088014660 11:105044391-105044413 GAGACGCTGGGACTCTCAGCAGG - Exonic
1091445601 12:542834-542856 AAGATGCTGGGAAGCCCAGATGG + Intronic
1092239826 12:6829663-6829685 AGAACGTTGGGACTCTCAGAAGG - Intronic
1098084568 12:66828730-66828752 AGTATAGTGCGACTCTCAGAAGG - Intergenic
1099071826 12:78054031-78054053 AATATGTTGGGAATTTCAAAAGG + Intronic
1100728015 12:97430534-97430556 AAAATCCTGGCTCTCTCAGAAGG + Intergenic
1107357259 13:39581198-39581220 AATCTGATGGGATTCTAAGATGG - Intronic
1109787570 13:67200141-67200163 AACATGCTGGGACTTTTAAATGG + Intronic
1111148998 13:84223461-84223483 AATATGTTTTGACTCTAAGAGGG - Intergenic
1112377135 13:98853815-98853837 AATATACTTGGCATCTCAGAAGG - Intronic
1115430717 14:33315406-33315428 AATATGGTGGGAATGTTAGATGG + Intronic
1115502961 14:34065456-34065478 GATAAGCTGGAAATCTCAGAAGG + Intronic
1116084850 14:40221966-40221988 AATATCATTGGACTGTCAGAAGG - Intergenic
1116866654 14:50036930-50036952 AATATGCGGGGCCTCTGAGAAGG - Intergenic
1118085709 14:62414018-62414040 AAAATGCTATCACTCTCAGATGG - Intergenic
1120470137 14:84912736-84912758 ATTAAGCTTGGACTCACAGAGGG - Intergenic
1121767132 14:96497662-96497684 CATGTGCTGGGACTCTCTGAAGG + Intergenic
1126228923 15:46302859-46302881 AGTATGCTGTGCTTCTCAGATGG - Intergenic
1127873710 15:63094396-63094418 AATATTCTGAGAATCTCAGATGG - Intergenic
1129329712 15:74820798-74820820 AGGATGCTGTGACACTCAGATGG - Intronic
1132341951 15:101084649-101084671 AGGATGCTGGGAGTCTCAAAGGG - Intergenic
1132710473 16:1264032-1264054 CACCTGCTGGGAGTCTCAGAGGG + Intergenic
1133182929 16:4072334-4072356 CATAAGCTGGAAATCTCAGAGGG - Intronic
1134402265 16:13920701-13920723 ACTGTGCGGGGACTCTGAGAGGG + Intronic
1137041408 16:35616156-35616178 AATGTGCTGGAACTCTAAAAGGG - Intergenic
1139892938 16:70265730-70265752 AGGATGCTGGGACTGGCAGAAGG + Intronic
1143345351 17:6245076-6245098 AAGATGCTGAGACTTGCAGAGGG - Intergenic
1143993841 17:10989947-10989969 AGAATGCTGGGAGTCTCTGAGGG - Intergenic
1144821946 17:18081328-18081350 AAGATGCCAGGATTCTCAGAAGG + Intergenic
1145984257 17:29034138-29034160 AATATGCTGAGACCCCCAAAGGG + Intronic
1148072746 17:44917623-44917645 TCTGTGCTGGGACTCACAGAGGG - Intergenic
1148533710 17:48420209-48420231 AATATGTTAAGATTCTCAGATGG + Intronic
1148625445 17:49065841-49065863 ACTATGCAAGGACTCTTAGATGG + Intergenic
1150818975 17:68419695-68419717 AAAATGCTGGGATTATCAGCAGG - Intronic
1156216913 18:35008519-35008541 AAGATGCTGTGACTCACAGTAGG - Intronic
1158500268 18:57994546-57994568 TATGTTCTGAGACTCTCAGAAGG - Intergenic
1161467942 19:4442558-4442580 CCTATGCTGGGAGTCTCAGGTGG + Intronic
1165921309 19:39299635-39299657 GCTATACTGGGACTATCAGATGG - Intergenic
928378944 2:30801943-30801965 CAGATGATGTGACTCTCAGATGG + Intronic
929023113 2:37573933-37573955 AAAATGCTTGAACGCTCAGAAGG + Intergenic
929375586 2:41282955-41282977 AATGTGTTTGGAATCTCAGAAGG - Intergenic
929738725 2:44579451-44579473 AAAATGCTTTGCCTCTCAGATGG - Intronic
931794225 2:65693888-65693910 AATCTTCTTGGACTCTCAGAAGG - Intergenic
933755008 2:85631558-85631580 AATCTCCTGGGACTCTTAGCAGG - Intronic
936850576 2:116893041-116893063 AATAGGCTGGCTATCTCAGATGG + Intergenic
940028823 2:149238819-149238841 AATGTGCTGGGATTACCAGAAGG - Intergenic
940591436 2:155733329-155733351 AAGCTGCTGGGTCTGTCAGAGGG - Intergenic
941549033 2:166890818-166890840 AGTTTTCTGGGACTCTGAGATGG + Intronic
941570819 2:167168351-167168373 AATGTAATGGGACTCTCAGAAGG - Intronic
941613598 2:167693069-167693091 AATCTTCTGGGGCTCTCAGTGGG + Intergenic
943718920 2:191182482-191182504 AATATGCTGTGAAAGTCAGAGGG - Intergenic
944066013 2:195619828-195619850 AGTATGCTGGGACTGGCAGGCGG - Intronic
946695396 2:222352585-222352607 AATAAGCTGGTACACTCAGAGGG + Intergenic
947153838 2:227140755-227140777 AATTTGCTGAGACTCCAAGATGG + Intronic
948395319 2:237640948-237640970 AATATGCTGGAACATTCACATGG - Intronic
948974978 2:241458413-241458435 GGGATGCTGGGACTCTCAGCAGG + Intronic
1173478077 20:43377136-43377158 AATTTACTGAGACTCTCAAAAGG - Intergenic
1176976437 21:15326927-15326949 AATATGGAGGGAGTCTAAGATGG - Intergenic
1181964410 22:26646493-26646515 AAGATGATGGGAGCCTCAGAAGG + Intergenic
1184098670 22:42330080-42330102 AATCTGCAGGGCCACTCAGATGG - Intronic
949901851 3:8821694-8821716 AGGATACAGGGACTCTCAGAGGG - Intronic
951741427 3:25928985-25929007 GATATGCTGGGAGTCACAGAGGG + Intergenic
952071804 3:29646381-29646403 AAGTGGCTGAGACTCTCAGAAGG + Intronic
953853802 3:46485397-46485419 AAACTGCTGGCACTCCCAGAGGG - Intergenic
954924601 3:54221327-54221349 AATATGCTGGTAATCTCAAATGG - Intronic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
958564346 3:95789018-95789040 AATATTCTGGGATTCACACATGG - Intergenic
960725844 3:120668899-120668921 AATACACTGGGGTTCTCAGAAGG + Intronic
961649478 3:128410283-128410305 AATGTGCAGGGACTCTGAGGGGG - Intergenic
962602073 3:136999589-136999611 AATAAGATTGGACTCACAGAAGG - Intronic
963360978 3:144271551-144271573 CATATGCTGTGAATCTCAGTTGG - Intergenic
965227176 3:166004824-166004846 ATTGTGCTGTGAGTCTCAGAGGG + Intergenic
968841588 4:3010541-3010563 AATATGATGGGTCTCCTAGATGG + Intronic
970360342 4:15302953-15302975 AATATGTTGGAGCTCTCACATGG + Intergenic
973076071 4:45927674-45927696 GATATGGTGGAATTCTCAGAAGG + Intergenic
974195532 4:58569896-58569918 AAAATGTGGGGACTCTCTGAAGG - Intergenic
974518392 4:62946039-62946061 AATATACTGGGAATTTCAAAAGG + Intergenic
978965500 4:114735788-114735810 AATTGGCTGAGACTCTCTGAAGG + Intergenic
980164665 4:129210745-129210767 CATATGCTGGCACTCTTAGAAGG + Intergenic
980873501 4:138636936-138636958 AATATGCTGCCACTGTCAGCCGG - Intergenic
981867022 4:149434783-149434805 GATCTGGTGGGTCTCTCAGAAGG + Intergenic
982276288 4:153639903-153639925 GATATGCTGGGCCTTTCACACGG - Intergenic
984511857 4:180688682-180688704 AATATGCTGAGTCTCACAGTGGG + Intergenic
985130002 4:186729426-186729448 AATCAGCTTGTACTCTCAGAGGG + Intergenic
986540814 5:8841988-8842010 AAGATCCTAGGACTCACAGAAGG + Intergenic
988431439 5:31123538-31123560 AAAACTCTGGAACTCTCAGAGGG + Intergenic
988478077 5:31605691-31605713 AATATGATGGAAGTCTCAAAAGG - Intergenic
990298272 5:54425226-54425248 CCTTTGCTGGGGCTCTCAGAAGG - Intergenic
994635049 5:102334452-102334474 CAGATGGTGAGACTCTCAGAAGG + Intergenic
995016875 5:107319734-107319756 AATAAGCTGGGAGGCTGAGAGGG - Intergenic
995341908 5:111070306-111070328 CATTTGCTGGGACTCACACACGG + Intronic
995726977 5:115191562-115191584 AATATGCTGGCACTCCTAGGAGG - Intergenic
995871163 5:116744938-116744960 AATATCCTGGTATTCTAAGAGGG + Intergenic
998213414 5:140218886-140218908 AATATGCTGGGAGGGCCAGAGGG - Intronic
1000552533 5:162684790-162684812 AATATACTGTGACTCTCTGTTGG - Intergenic
1001232219 5:169998341-169998363 CATAGGCTGGTGCTCTCAGAAGG - Intronic
1006246311 6:32739977-32739999 AACATGCTGAGAATCTCAGAAGG + Intergenic
1011584688 6:88911843-88911865 CATCTGCTTGGCCTCTCAGAGGG - Intronic
1012738581 6:102982725-102982747 ATTTTGCTGAGACTCTGAGAGGG - Intergenic
1023595607 7:41826686-41826708 CCTTTGCTGGGACTCTCAGAAGG - Intergenic
1023891282 7:44393680-44393702 AGTGTGATGGGACTCTCTGATGG + Intronic
1024703151 7:51926661-51926683 TATATTCTGGGACTCTTATAAGG + Intergenic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1027593615 7:80144956-80144978 AAGTTGCTGGGACTATAAGATGG + Intronic
1028194087 7:87885171-87885193 AATATGCTTTGAGACTCAGAAGG + Intronic
1029153985 7:98502027-98502049 AATGCACTGGGACTCTCTGAGGG - Intergenic
1030768519 7:113442207-113442229 AATACACAGGGACTTTCAGAAGG - Intergenic
1031191599 7:118559145-118559167 TATATAATGTGACTCTCAGAAGG + Intergenic
1034753602 7:153593425-153593447 AACATAATGGAACTCTCAGAAGG - Intergenic
1037817098 8:22118080-22118102 CAGATGCTGGGACACGCAGAGGG - Intronic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1039147393 8:34464173-34464195 AAAATCCTGAGACTCTAAGACGG + Intergenic
1039432483 8:37535706-37535728 AATATGCAGGGAGTCCCAAATGG - Intergenic
1039876786 8:41593334-41593356 AATGTGCTGGAACTCTAAAAAGG - Intronic
1040306406 8:46214155-46214177 AAAATGCTGGGACCCTCCCAAGG + Intergenic
1042656175 8:71099555-71099577 AGTATGCTGGAATTCTCATATGG + Intergenic
1043224328 8:77703797-77703819 AAGATGCTGAGATTCTCATAAGG + Intergenic
1044889031 8:96812791-96812813 AAAATGCTGAGTCTCTCCGAAGG + Intronic
1045867156 8:106880917-106880939 AATATGCTGGGCCTTTGTGATGG + Intergenic
1045934691 8:107665043-107665065 AAGATGCTGGGAATCCCATATGG - Intergenic
1047251793 8:123186443-123186465 CTCATGCTGGGACTCTCAGTTGG - Intronic
1048256318 8:132907535-132907557 AAGATTCTGGGACTGTCACAAGG + Intronic
1056451820 9:86723732-86723754 GAGATCCTGGGACTCACAGAGGG + Intergenic
1056839085 9:89983330-89983352 CATATTTTGGGAGTCTCAGAAGG + Intergenic
1058442756 9:105024945-105024967 AGGATGCTGGGATTTTCAGAGGG + Intergenic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1060988937 9:127837333-127837355 AAAATGCTGGGACCCCCAGAAGG - Intronic
1188441633 X:30219262-30219284 AATATGTTGGGAGTCTATGATGG + Exonic
1188444565 X:30242808-30242830 AATATGCTGGGGATCTATGATGG + Exonic
1189539813 X:41974335-41974357 AACATGATTGAACTCTCAGAAGG + Intergenic
1189865152 X:45320217-45320239 AATCTCCTGGGACAATCAGAAGG + Intergenic
1192903212 X:75522396-75522418 AATATTTTGGAACTCTCAGTAGG + Intronic
1201305055 Y:12542743-12542765 AACATGGTGGGCCTCACAGAGGG + Intergenic