ID: 954977477

View in Genome Browser
Species Human (GRCh38)
Location 3:54709948-54709970
Sequence TAATACCTCTACCAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954977477_954977482 30 Left 954977477 3:54709948-54709970 CCTACCACCTGGTAGAGGTATTA 0: 1
1: 0
2: 2
3: 4
4: 67
Right 954977482 3:54710001-54710023 TGTTTTCACACACGCACACAGGG 0: 1
1: 0
2: 2
3: 33
4: 273
954977477_954977481 29 Left 954977477 3:54709948-54709970 CCTACCACCTGGTAGAGGTATTA 0: 1
1: 0
2: 2
3: 4
4: 67
Right 954977481 3:54710000-54710022 TTGTTTTCACACACGCACACAGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954977477 Original CRISPR TAATACCTCTACCAGGTGGT AGG (reversed) Intronic
900999650 1:6142409-6142431 TACTCCCTCTACAAGGAGGTGGG - Exonic
904472074 1:30742196-30742218 TATCACCTTTACCAGCTGGTGGG + Intronic
919945304 1:202314933-202314955 TAATACCTCAACTAGGTGGTTGG - Intronic
920643318 1:207775754-207775776 AAACACCTCAAACAGGTGGTGGG - Intronic
922220917 1:223557909-223557931 TAAGACCTCCCCCAGGGGGTAGG + Intronic
1063100780 10:2947934-2947956 TATTACATCTACCATGTGGTAGG - Intergenic
1066271049 10:33823839-33823861 TAACACCTTTGCCAGGTGGAAGG - Intergenic
1071750894 10:88474557-88474579 TAATACCTCTTCAAGTTGGAAGG + Intronic
1072524600 10:96260106-96260128 CAAGACCTCTGCCAGGTGGGTGG - Intronic
1084540419 11:69782748-69782770 CAACACCTCTTCCAGGGGGTGGG - Intergenic
1085854164 11:80157400-80157422 TGATAACTGTACCAGGTAGTTGG + Intergenic
1090507909 11:127339313-127339335 TAATACCTTTACAAGGAGGTAGG - Intergenic
1100987333 12:100215228-100215250 TAAAACCTCTTCCAGATGATTGG + Intronic
1102064669 12:109964011-109964033 TAATATCTCTAGCACGTGGCAGG - Intronic
1107352126 13:39526202-39526224 TAATCCCTGTACCAGGGGCTTGG - Intronic
1109278459 13:60328368-60328390 TAAAACTTCTGTCAGGTGGTAGG - Intergenic
1109912409 13:68931933-68931955 TAATACCTCTACCACAGGATAGG + Intergenic
1113580203 13:111423258-111423280 TAAAATCTCTACCAGGTTTTAGG - Intergenic
1113976998 13:114235118-114235140 CAGTACCTCGACCAGGTGGGCGG + Exonic
1116787251 14:49301171-49301193 GAATACCTCTACCAGGTATCTGG + Intergenic
1122354432 14:101114565-101114587 TAAGACATCTGCCAGGTTGTAGG + Intergenic
1130387540 15:83424710-83424732 TAAGGCCTCTATCAGGTTGTAGG + Intergenic
1132223385 15:100122244-100122266 TATTAGCTATAACAGGTGGTTGG - Intronic
1151674948 17:75592527-75592549 TACTACCTCAACCAGGTCGGGGG + Intergenic
1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG + Intronic
1155104090 18:22643326-22643348 TAATTCCTCTACCTGCTGATTGG - Intergenic
1157183668 18:45519914-45519936 TGATACCACTGCCAGGTAGTTGG - Intronic
1159096180 18:63904942-63904964 TAATAACTCTGCAAGGTGGTAGG + Intronic
1165797546 19:38527770-38527792 TACTACCTGGACCAGGTGGGTGG + Exonic
928748889 2:34448149-34448171 TAATTCATCTACCAGTGGGTGGG + Intergenic
929271682 2:39979964-39979986 TTATACCTCTTCCTGGTGGTTGG + Intergenic
932145407 2:69311396-69311418 TAATACCTGTAACATGTGGAAGG - Intergenic
932329863 2:70892106-70892128 TAGTGCCTGTCCCAGGTGGTGGG - Intergenic
935617984 2:105104879-105104901 TAAGGCCTGTACCAGGTGGGAGG + Intergenic
948369689 2:237480900-237480922 GCATCCCTATACCAGGTGGTGGG - Intergenic
1172004449 20:31809116-31809138 TCTTAACTCTACCAGGAGGTTGG + Intergenic
1182866699 22:33610662-33610684 TAATATCTCTAGCAAGTTGTGGG - Intronic
1184929314 22:47669245-47669267 CAACACCTGTTCCAGGTGGTTGG + Intergenic
954977477 3:54709948-54709970 TAATACCTCTACCAGGTGGTAGG - Intronic
960824955 3:121772769-121772791 TAAAACCTCTGCTAAGTGGTTGG - Intronic
963513823 3:146282530-146282552 ATAAACCTCTACCAGGTGATGGG - Intergenic
966211952 3:177462896-177462918 CAATACCTGTTCCATGTGGTGGG - Intergenic
966235114 3:177692178-177692200 TAAAACCTCTTTCAGGTGATTGG - Intergenic
970550400 4:17174597-17174619 TGATATATATACCAGGTGGTTGG - Intergenic
979497770 4:121403365-121403387 TAAAAACTCTACCATGTGTTAGG - Intergenic
980941788 4:139281402-139281424 AAATGCCACCACCAGGTGGTGGG + Intronic
991031362 5:62085465-62085487 TATTACCTCTATGAGATGGTAGG - Intergenic
993843194 5:92906708-92906730 TTATACCACTAGCAGGTGGCAGG - Intergenic
998189967 5:140015286-140015308 TAAAACTTCTTCCAGGTGCTTGG - Intronic
1000439186 5:161247085-161247107 TAATTCCTCTCCCAGGAGTTTGG - Intergenic
1004104136 6:12648544-12648566 TAACACCTCTACCAGACAGTAGG - Intergenic
1008815851 6:55565195-55565217 CAGTACCTCTACCAGGTGAGTGG + Intronic
1009292070 6:61894784-61894806 GAACACCTCGTCCAGGTGGTGGG + Exonic
1011858813 6:91729126-91729148 TTATCCCTCTACTAGTTGGTAGG + Intergenic
1012949556 6:105503470-105503492 TAAGATCTCTGCCAGGTGGCAGG - Intergenic
1014245244 6:119060986-119061008 TAATACATCTTCCATGTGGCTGG + Intronic
1014629328 6:123770229-123770251 AACTACATCTACCAGGTGGCTGG - Intergenic
1023758145 7:43439509-43439531 TAGCACCTCTGCCAGGGGGTGGG + Intronic
1027399529 7:77793151-77793173 TATTACCTCTACCTTCTGGTTGG - Intergenic
1033549766 7:142436275-142436297 CAACACCTCAGCCAGGTGGTGGG + Intergenic
1040039626 8:42903132-42903154 TTGCACCTCTACCAGGTGTTTGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1048056532 8:130871826-130871848 TAAGAATTCTACCCGGTGGTGGG - Intronic
1048546648 8:135393767-135393789 TAATACTTTCACCAGGTGGAGGG + Intergenic
1059131007 9:111749250-111749272 TAATACATCTTGCAGTTGGTAGG + Intronic
1060459821 9:123840502-123840524 TAATAACTCTGCCAGGTAGGTGG - Intronic
1187378030 X:18774865-18774887 TAATCTTTTTACCAGGTGGTAGG + Intronic
1187760897 X:22583415-22583437 TAATACCTCTTTCAGGTTGATGG + Intergenic
1193212687 X:78826262-78826284 TGATACTTGTACCTGGTGGTTGG + Intergenic
1193215637 X:78860842-78860864 TACTACCACCACCAGGTGTTTGG - Intergenic
1196900796 X:120380908-120380930 TAACACCTCCACCAGGGGGAAGG + Exonic
1201439049 Y:13988372-13988394 TAATACTTCTAACATGAGGTTGG + Intergenic
1201445524 Y:14054336-14054358 TAATACTTCTAACATGAGGTTGG - Intergenic
1201631980 Y:16079376-16079398 TAATACCCCTACTTGGTGTTAGG + Intergenic