ID: 954979442

View in Genome Browser
Species Human (GRCh38)
Location 3:54731026-54731048
Sequence TCTACCACACAGAACTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954979442 Original CRISPR TCTACCACACAGAACTAGGT TGG Intronic
902005553 1:13229188-13229210 TCTTCCACTCAGGACTAGGAAGG + Intergenic
902024873 1:13375465-13375487 TCTTCCACTCAGGACTAGGAAGG + Intergenic
902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG + Intronic
905634616 1:39541652-39541674 TCAAACACACAGGACCAGGTAGG - Intergenic
911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG + Intergenic
913194504 1:116444511-116444533 TCTACCAGAAAGTACTAGGAGGG + Intergenic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
1064745795 10:18477045-18477067 TCTGCCACACAGAAAAAGGAGGG + Intronic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1075135924 10:119786289-119786311 CATACCACACAGAACTGGCTGGG + Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1079646822 11:22874133-22874155 TCTAACACGCAAAACCAGGTAGG - Intergenic
1081585212 11:44379633-44379655 ACTCCCACACAGACTTAGGTTGG + Intergenic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1084918815 11:72452176-72452198 TGTACCACACAGCATTAGCTGGG - Intergenic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1090961441 11:131561041-131561063 TTTGCAACACAGAACTAGGAAGG - Intronic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG + Intergenic
1101506231 12:105349293-105349315 TCTCCCACCCAAAACTGGGTTGG + Intronic
1109463099 13:62690102-62690124 TTTACCAAACATAACTTGGTAGG + Intergenic
1110477410 13:75932694-75932716 TCTACCACATAAAACCAGGAAGG - Intergenic
1117659120 14:57985936-57985958 TTTTCCACACAGAACTTTGTGGG + Intergenic
1119676990 14:76563191-76563213 TCTCCCACCCAGAACTCTGTTGG + Intergenic
1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG + Intergenic
1121202277 14:92128320-92128342 TCTACCAAAAAGAATTAGCTGGG + Intronic
1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG + Intergenic
1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG + Intronic
1131046230 15:89317965-89317987 TCTGCCACTCAGAACCAGTTTGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG + Intergenic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1151057310 17:71048565-71048587 GCTACCACATAGAACTAAGCAGG - Intergenic
1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG + Intronic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1158934279 18:62350204-62350226 TAAACCACACAAAAATAGGTGGG - Intronic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1162125619 19:8498279-8498301 TCTACCCCACAGATCTACGGAGG - Exonic
1168545033 19:57243053-57243075 TCTACCAAAAAGAAATAGTTGGG + Intronic
926003256 2:9351508-9351530 CCTGCCACACAGAACTACCTAGG - Intronic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG + Intergenic
944434533 2:199672868-199672890 TCTACCAAACAGAAGAGGGTGGG - Intergenic
944473838 2:200084272-200084294 TCTACTCTACAGAAATAGGTGGG + Intergenic
945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG + Intergenic
945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG + Intronic
945906488 2:215599589-215599611 TCCACCTCACAGAGCTAGGCAGG - Intergenic
946661622 2:222007150-222007172 TCCCCCACACAGACCAAGGTTGG - Intergenic
1172978498 20:38923955-38923977 TGTCCCACACAGAACTTTGTTGG + Intergenic
1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG + Intronic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1178584014 21:33858064-33858086 TCAACCACACAGAGCTTGGAGGG + Intronic
1185388137 22:50545889-50545911 TCTACCAGGCAGAAGCAGGTTGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
957116576 3:76034555-76034577 TCTAACACACAGAACTAATGTGG - Intronic
957730536 3:84127881-84127903 GCTAAGACACAGAACAAGGTAGG - Intergenic
958905208 3:99934473-99934495 TGTTCCACACAGGACTATGTGGG - Intronic
960926339 3:122798282-122798304 TCTACCATAAAAAACAAGGTTGG - Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
969870919 4:10104154-10104176 TCTATCACCCAGAGATAGGTAGG - Intronic
971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG + Intergenic
976708502 4:88043479-88043501 ACAACCACACAGAAATAGGAGGG - Intronic
980207290 4:129736350-129736372 TATAGCATTCAGAACTAGGTAGG + Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
989519940 5:42389785-42389807 TCTTCCTAACAGAACTTGGTTGG - Intergenic
990016011 5:51063689-51063711 TCTCCCACAGGGAACTAGGCAGG - Intergenic
991858046 5:70987356-70987378 TATATCCCAGAGAACTAGGTAGG + Intronic
991871204 5:71112242-71112264 TATATCCCAGAGAACTAGGTAGG + Intergenic
992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG + Intronic
995597582 5:113764363-113764385 TTTACTTCTCAGAACTAGGTAGG - Intergenic
1011370846 6:86634771-86634793 TCTGACACACAGAGCTACGTGGG - Intergenic
1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG + Intronic
1019455686 7:1125952-1125974 TTTAACACTCAGAACTTGGTGGG + Intronic
1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG + Intergenic
1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG + Intergenic
1024142535 7:46476907-46476929 TCTCAAACACAGAAATAGGTTGG + Intergenic
1028365203 7:90021119-90021141 TCTACCTCACAGAATTATGAGGG + Intergenic
1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG + Intronic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1030133122 7:106219954-106219976 TCTAAATCACAGAACTAGGAGGG - Intergenic
1037924572 8:22834226-22834248 TTTCCCATACAGAACTTGGTGGG - Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1045829409 8:106440507-106440529 TCTATCACCCAGAACTAGAAAGG - Intronic
1048574776 8:135681836-135681858 TGCACCACACAGAACCAGATAGG - Intergenic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1052286562 9:26792622-26792644 TCTACCAAACTGAACAATGTGGG - Intergenic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1187096888 X:16158127-16158149 CCTCAGACACAGAACTAGGTGGG - Intergenic
1188779820 X:34268101-34268123 TCTGCCTCACAGAACAAGGTAGG - Intergenic
1193250710 X:79288363-79288385 GCTACCACACAGAACTCTCTGGG - Intergenic
1194188794 X:90808676-90808698 TCTGACACACGGAACTACGTGGG - Intergenic
1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG + Intronic
1197772141 X:130095961-130095983 TCTACCACAGAGAATAGGGTGGG - Intronic
1200535377 Y:4390573-4390595 TCTGACACACGGAACTACGTGGG - Intergenic