ID: 954989235

View in Genome Browser
Species Human (GRCh38)
Location 3:54825255-54825277
Sequence CCTTCTGTGTAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954989235_954989241 -5 Left 954989235 3:54825255-54825277 CCTTCTTCCTTCTACACAGAAGG 0: 1
1: 0
2: 2
3: 37
4: 359
Right 954989241 3:54825273-54825295 GAAGGGAAGGTAGAGGATCGAGG 0: 1
1: 0
2: 1
3: 21
4: 374
954989235_954989243 26 Left 954989235 3:54825255-54825277 CCTTCTTCCTTCTACACAGAAGG 0: 1
1: 0
2: 2
3: 37
4: 359
Right 954989243 3:54825304-54825326 TTCACAAAGCCCTCTGAATTGGG 0: 1
1: 0
2: 1
3: 29
4: 193
954989235_954989242 25 Left 954989235 3:54825255-54825277 CCTTCTTCCTTCTACACAGAAGG 0: 1
1: 0
2: 2
3: 37
4: 359
Right 954989242 3:54825303-54825325 TTTCACAAAGCCCTCTGAATTGG 0: 1
1: 0
2: 1
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954989235 Original CRISPR CCTTCTGTGTAGAAGGAAGA AGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901407481 1:9059097-9059119 CCATCAGAGTAGATGGAAGAAGG - Intronic
901599906 1:10415279-10415301 CGTGCTGTATAGAAGGAAGTTGG + Intronic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904976792 1:34462651-34462673 CCCTCTGTAAAGAAGGAAGGGGG + Intergenic
905792078 1:40795127-40795149 CATTCTATGTATAAGGAAGCTGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907901112 1:58742123-58742145 CCTTCTGCTTAGATGGAAAAAGG - Intergenic
908469781 1:64432431-64432453 CCTTTTGTGGAAAAGGAAAAGGG + Intergenic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
908774058 1:67623061-67623083 ACTTCTGTGTAGAAGTGAAATGG - Intergenic
909113007 1:71503580-71503602 CCTGCTGTGTGGAAGGGATAGGG - Intronic
909181055 1:72424615-72424637 ACTTGAGGGTAGAAGGAAGAAGG + Intergenic
909595982 1:77406535-77406557 CCTTCTGTCTAAAAGCAAGGGGG - Intronic
909929583 1:81480531-81480553 CTTTCTCTGTATAAGAAAGATGG + Intronic
910856403 1:91700268-91700290 CCTTCTGTGGTGAATGAAAATGG - Intronic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
918294483 1:183143279-183143301 CCTTTTGCTTAGAAGGAAGAGGG - Exonic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919467281 1:197937499-197937521 CATTCTGTGTACAAGAAAGAGGG + Intergenic
919992115 1:202715225-202715247 ACTTCATTGCAGAAGGAAGAAGG - Intergenic
920256981 1:204662106-204662128 CCTTCTGTCCAACAGGAAGAAGG + Intronic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921579119 1:216874534-216874556 GCCTCTGTATGGAAGGAAGAAGG - Intronic
921706000 1:218323603-218323625 GCTTCTGGGTAGAAGGGGGAGGG - Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
923393666 1:233539179-233539201 CTTTCTGTGTAGAATGAGGTAGG - Intergenic
923541763 1:234893354-234893376 CCTTCTGTGTGCCAGGAACAGGG + Intergenic
923794761 1:237142995-237143017 CCTTCTTTTTTCAAGGAAGAAGG - Intronic
924788163 1:247219563-247219585 CCTGCTGTGTGGAAGGGATAGGG - Intergenic
924805042 1:247355241-247355263 CCTGCTGTGTGGAAGGGATAGGG - Intergenic
924941624 1:248816260-248816282 CCTTCTGTGTATCAGGAATCAGG - Intronic
1062997609 10:1881687-1881709 GTTTCTGTGGAAAAGGAAGAGGG + Intergenic
1063173296 10:3529098-3529120 CCTGATGTGTGGAAGGAAGCTGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1064269039 10:13848785-13848807 CCTTGGCTGAAGAAGGAAGATGG + Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1067478920 10:46583135-46583157 CCCTCTGTGGAAAAGGGAGAAGG + Intronic
1067615818 10:47758666-47758688 CCCTCTGTGGAAAAGGGAGAAGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1069702716 10:70438451-70438473 CCCTCTCTGTAAAAGGGAGATGG + Intronic
1070746343 10:78936161-78936183 CCTTCTGGGCAAATGGAAGAGGG - Intergenic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073447976 10:103592370-103592392 CCTTCTGTGTGGGAGGGAGCGGG + Exonic
1073514813 10:104066812-104066834 TCTGCTGTTTAGAAGGAATAGGG - Intronic
1073544677 10:104338207-104338229 CCTAGTGTGCTGAAGGAAGAAGG - Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1074950513 10:118329747-118329769 TCTTCTATGTAGAAGGAACTGGG - Intronic
1074956012 10:118390564-118390586 CCATTTGGGGAGAAGGAAGAAGG - Intergenic
1075009256 10:118853743-118853765 CCATCTGTGTGGAAGGAATGTGG - Intergenic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1075907429 10:126093768-126093790 CATGGTGTGTACAAGGAAGAGGG - Intronic
1076980845 11:203939-203961 CTTGCTGTGTGGAAGGAAGGAGG + Exonic
1077743911 11:4879715-4879737 ACTTATGCGTAGAAGGTAGATGG + Intronic
1077781447 11:5334295-5334317 CCTCCTTTGGAGAAGGAAGTGGG + Intronic
1077900527 11:6483872-6483894 CCTGCTGTGTAAAATGAACATGG - Exonic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078573055 11:12475904-12475926 CTTTCTGTGCAGGAAGAAGATGG + Intronic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1079353263 11:19711382-19711404 TCTTCTGTGGACCAGGAAGAGGG - Intronic
1079398466 11:20086231-20086253 TGTTCTGTGTATAAGGAATATGG + Intronic
1079719631 11:23793457-23793479 CCTTATGTGTAGAAGGAATGTGG + Intergenic
1080337576 11:31215836-31215858 GCTTCTTTTTAGAAGGAAAAAGG - Intronic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1080609566 11:33892234-33892256 CATTCTGAGTAGGAGGATGAGGG - Exonic
1080875624 11:36271774-36271796 CTTTCGGTGTGGCAGGAAGATGG + Intergenic
1080885635 11:36365151-36365173 CCTTCTGTGAAGGAGGTAGCTGG + Intronic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1081003940 11:37710219-37710241 CCTTTTGTGTAGGAGGCAGATGG + Intergenic
1081249683 11:40814257-40814279 ACTTCTGTGTAGCAGCAATATGG + Intronic
1084024923 11:66441943-66441965 CCTGCTGTGTGGAAGGGATAGGG + Intronic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1084544473 11:69807811-69807833 CCTCCTGTGTGTAAGGAAGCAGG + Intergenic
1085192720 11:74642312-74642334 CCTTCTTTTTAAAAGGAAAAAGG + Exonic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1086664714 11:89466065-89466087 CCATCTGTCAACAAGGAAGAGGG + Intronic
1086911498 11:92477961-92477983 CCTTCAGTGTAGAAGCCAGAAGG + Intronic
1087089589 11:94254824-94254846 CCTTCAGTGGAGAAGGTAGTAGG - Intergenic
1087156227 11:94907557-94907579 TCTTCTCTGTAAATGGAAGATGG - Intergenic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1088321590 11:108559809-108559831 CCTTCTGTGTCTAAGCAAAAAGG + Intronic
1088665021 11:112085929-112085951 CCTTTTGGGTGGGAGGAAGAGGG - Intronic
1088762038 11:112940380-112940402 CCATTTGTTTAGAAGGAACAGGG - Intergenic
1090547917 11:127785476-127785498 CCTTCTGGGTAAAATGATGATGG + Intergenic
1090819507 11:130328559-130328581 CCTCCTGAGTAGATGGAAGCTGG - Intergenic
1091135435 11:133184469-133184491 CCTTCCGTGGGGAGGGAAGAAGG + Intronic
1091169448 11:133507266-133507288 CCCTCTGTGGAGCAGGAGGATGG + Intronic
1091268563 11:134289738-134289760 CCCTCCGTGAAGAAGCAAGAGGG - Intronic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091826715 12:3518281-3518303 CCTGCTGTTTACAAGGAAGAGGG - Intronic
1093154936 12:15671863-15671885 CATTCTGTTTAGAAGAAATAGGG - Intronic
1093289600 12:17303787-17303809 CCTTATGGGTAGCAGGAAAAAGG - Intergenic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1095538776 12:43283715-43283737 CACTCTGTGTAAAATGAAGATGG - Intergenic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1098063541 12:66587794-66587816 CATTCCGTGCAGAAGGCAGAGGG + Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1098876897 12:75875084-75875106 CTTTCTGTGAAGAATGATGATGG - Intergenic
1099162126 12:79255242-79255264 GCTTCTGTGTTGAAGGCTGATGG - Intronic
1100207179 12:92363493-92363515 CCCTCTGTCGAGATGGAAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1101930200 12:109007469-109007491 ACTTCTGGGTATAAGAAAGAAGG + Intronic
1102632199 12:114290875-114290897 CATTCTGTGGAGAAGAAACAAGG + Intergenic
1102698481 12:114818140-114818162 CCTTCTTGGTAGAAGGCAGGCGG + Intergenic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1103997837 12:124841649-124841671 CCTGCTGTGTTGGAGGAAGAGGG - Intronic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104182692 12:126398104-126398126 GCTTGGGTGTAGAAGGGAGATGG + Intergenic
1104711478 12:130989875-130989897 CTTTCTGTAGAGGAGGAAGAAGG + Intronic
1106044876 13:26129632-26129654 ACTGCTGTGTAGAGGGCAGAAGG - Intergenic
1106305163 13:28503315-28503337 CCTTCTGTGAAGAGGCCAGAAGG - Intergenic
1106576342 13:30979108-30979130 AATCCTGGGTAGAAGGAAGAGGG - Intergenic
1107057625 13:36124338-36124360 CCCTCTGAATAGAAGGAAAAAGG + Intronic
1107527342 13:41246189-41246211 GCATCTGTGCAGGAGGAAGAAGG - Intronic
1108394685 13:49980855-49980877 CCCATTGTGTGGAAGGAAGATGG - Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1113680834 13:112243753-112243775 ACTTCTGTGGAGAAGGAGCAGGG + Intergenic
1114239026 14:20849023-20849045 CCTTCTGTGTGGTAGACAGAGGG + Intergenic
1114667865 14:24391253-24391275 ACTTCTTAGTACAAGGAAGAAGG + Intergenic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1117953620 14:61106363-61106385 TCTTCTGGGTAGTAGCAAGATGG + Intergenic
1118915709 14:70101836-70101858 CCTATTGTGGAGCAGGAAGATGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120130458 14:80800593-80800615 CCTCTTGTCTAGAAGGAACATGG - Intronic
1122357146 14:101130102-101130124 CCTCCTGAGTGGAAGGAAGGAGG - Intergenic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1125670843 15:41471591-41471613 CCTTCAGTATAAAAGGGAGAAGG + Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1126493771 15:49267604-49267626 CATTATGTGTAGAAGAAAAAGGG - Intronic
1127810469 15:62561006-62561028 CCTTCTGTGTAGAGGAAGAATGG - Intronic
1128058910 15:64721183-64721205 CGTTCTTTGTAGGAGAAAGAGGG - Intergenic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128982283 15:72196814-72196836 CCCTCTGAGTATAAGGCAGAGGG + Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129910980 15:79226076-79226098 CTTTCTGTGTAAAATGGAGATGG + Intergenic
1130423731 15:83774745-83774767 CATGCTGTGTAGAAGAATGATGG + Intronic
1130709338 15:86264413-86264435 CCTTCTGTGCAGGGTGAAGACGG + Exonic
1131563604 15:93465312-93465334 CCTTCTGTGTAGAAGAAAAAGGG - Intergenic
1132703065 16:1230172-1230194 CCCACTGGGTAGAAGGAACAGGG - Exonic
1132705257 16:1240696-1240718 CCCACTGGGTAGAAGGAACAGGG + Exonic
1132708386 16:1256059-1256081 CCCGCTGGGTAGAAGGAACAGGG + Intronic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1134206118 16:12239148-12239170 GCTTCTGTGATGAAGGAAGAAGG + Intronic
1134246106 16:12541340-12541362 AATTCTGTGAAGAATGAAGAAGG - Intronic
1134698774 16:16246375-16246397 CCTGGTGTGTAGCAGGAATATGG + Intronic
1134973060 16:18548298-18548320 CCTGGTGTGTAGCAGGAATATGG - Intronic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136498997 16:30660244-30660266 CCTTCTGTGGAGGAGGAGGTGGG - Exonic
1138125627 16:54436169-54436191 CCTTCTGTGGAGAAGCTATAAGG - Intergenic
1138803863 16:60069571-60069593 TGTTCTGTGCAGAAGGAAGTTGG + Intergenic
1140220810 16:73042605-73042627 TGTTCTGTGTAGATGGGAGAGGG - Intronic
1140692483 16:77497786-77497808 CCTTAGGTATAGAATGAAGATGG + Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1140960530 16:79907506-79907528 CTTTCTGGGTAGAAGGCAGCAGG + Intergenic
1141715304 16:85723651-85723673 CCTTCTGAGTGGATGGTAGAAGG + Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143824209 17:9590951-9590973 TCCTCTGTGTAGAAGCTAGATGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1148721328 17:49755360-49755382 TGTTCTGTGTAGCAAGAAGATGG - Intronic
1149688455 17:58553089-58553111 CCTTCAGTATAACAGGAAGAGGG + Intergenic
1152644723 17:81463480-81463502 ACTTCTGTGTGGCCGGAAGACGG - Intronic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1153703299 18:7718030-7718052 ACTTCTGTGAAGAATGATGATGG - Intronic
1155353197 18:24926576-24926598 AACTCTGTGTAGAAGGAATAAGG - Intergenic
1155463109 18:26105853-26105875 CCATCTGTGAACCAGGAAGAGGG - Intergenic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156939864 18:42754239-42754261 CCTTCTTTGTGGTAGGCAGAAGG + Intronic
1158149442 18:54351007-54351029 AGTTCTGTGAAGAAGGATGATGG + Intronic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1162708698 19:12575317-12575339 CTTTCTATGTAGAATGAAGCTGG - Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1163587657 19:18172903-18172925 CCTTCTGTGTAATGGGGAGAAGG - Intronic
1165093594 19:33398871-33398893 CCTTGTGGGTAAAAGGAAGAGGG - Intronic
1166137041 19:40783902-40783924 CCGGCTGTGGAGAAGGGAGAAGG - Exonic
1166654259 19:44598829-44598851 CCATCTCTACAGAAGGAAGAAGG - Intergenic
1168369259 19:55818171-55818193 CCTTCCCTGGAGAAGCAAGATGG - Exonic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
1168679717 19:58305664-58305686 CATTCTGTGTTGGAGGCAGAAGG + Intronic
925309229 2:2870465-2870487 CCCTCTGTGTAAAATGAGGAGGG - Intergenic
925850137 2:8073122-8073144 CCTAATGTGTAGAAAGGAGAAGG - Intergenic
926936102 2:18087819-18087841 TCTGCTGTTTAGAAGGAATAGGG + Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931127724 2:59296364-59296386 CCTTCTGTATGGAATGAGGAAGG - Intergenic
933521731 2:83382425-83382447 CCTTCTGTGAAGAATGATGTTGG - Intergenic
933787331 2:85853860-85853882 TCTTCTGCGTGGAAGGAAGCAGG + Intronic
933799392 2:85948738-85948760 ACTTCTGTGGAGATGGAATAGGG + Intergenic
934014317 2:87862806-87862828 CCTTCTGCATACTAGGAAGAAGG + Intergenic
934119040 2:88822698-88822720 CCTACTGTTTAGGAGGTAGAGGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935709706 2:105887309-105887331 CCTTCTGTAAAGAAGTAAAAGGG + Intronic
936162492 2:110095050-110095072 CCTCCTGTTTAGGAGGTAGAGGG - Intronic
936182168 2:110276316-110276338 CCTCCTGTTTAGGAGGTAGAGGG + Intergenic
936685747 2:114824123-114824145 TCTTATGTGTGGAATGAAGAGGG + Intronic
937347677 2:121136625-121136647 CCATCTGTGAACAAGGAAGTGGG + Intergenic
938853645 2:135287445-135287467 ACTTCTGTGAAGAATGATGATGG + Intronic
939227790 2:139385548-139385570 TTTTCTGTGTATAAAGAAGATGG + Intergenic
939638497 2:144611405-144611427 CCTTATGTAGAGAAGGAAAAGGG - Intergenic
939766627 2:146258086-146258108 CCTTCTGCAGAGAAAGAAGAAGG - Intergenic
939835757 2:147127164-147127186 CATTCTGTGAAGAATGATGATGG + Intergenic
940317198 2:152337294-152337316 CCATATGTCTAGTAGGAAGAGGG - Intronic
940551865 2:155169260-155169282 CCTTCTGTGGAGCAAGGAGAAGG - Intergenic
942901453 2:181124759-181124781 CATTCTGTGAAGGAGGAAGTAGG - Intergenic
943258214 2:185625019-185625041 CCTTATGTATGGTAGGAAGAAGG + Intergenic
944154616 2:196596291-196596313 CCTTCTGTGTTGTTGGAAGAGGG - Intergenic
945445981 2:209939250-209939272 CCTTCTGTAAAGCAGGCAGAAGG + Intronic
945884562 2:215361623-215361645 CATTCTGTTAAAAAGGAAGAAGG + Exonic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1170351669 20:15448095-15448117 CCTTCTGCTTGGAAGGTAGAAGG + Intronic
1170649405 20:18226351-18226373 GCTTATGTGTAGAAGGAATGAGG + Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172301996 20:33856883-33856905 GCTTCTGTTAACAAGGAAGAAGG + Intergenic
1173365598 20:42381818-42381840 TTTTCTGTGTTGAAGGTAGAAGG - Intronic
1173732010 20:45335641-45335663 CCTTTTTTTGAGAAGGAAGAAGG + Intronic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1179186085 21:39086274-39086296 CCTGCTGTTTAGCAGGGAGAAGG + Intergenic
1181319077 22:21990887-21990909 GCTTCTGGGTAGAATGAAGTGGG - Intergenic
1184046971 22:41977685-41977707 TCTTCAGGGTGGAAGGAAGAGGG + Intronic
1184246404 22:43237927-43237949 CCCTCTGTGCAGAAGGGTGAGGG - Intronic
1184280818 22:43436467-43436489 CCTTCTGTTTGGCAGGCAGAGGG + Intronic
1185109961 22:48895317-48895339 ACTTCTGTGTAGGAGGCAGGAGG + Intergenic
949555419 3:5148337-5148359 CCTGCTGTGTGGAAGGGATAGGG + Intronic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
950943459 3:16918667-16918689 CTTTATGTGTTGAAGGAAAAAGG + Intronic
951302341 3:21013398-21013420 AGTTCTGTGAAGAATGAAGATGG + Intergenic
951723433 3:25726558-25726580 GGTTCTGTGAAGAAGGGAGAAGG + Intronic
951764760 3:26185349-26185371 CCCTCAGGGCAGAAGGAAGAAGG - Intergenic
951810836 3:26697837-26697859 CCTTCTATGTACAAGGCACAGGG - Intronic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
952726989 3:36597008-36597030 AGTTCTGTGAAGAAGGGAGATGG - Intergenic
952933616 3:38378379-38378401 CCTGCTGTCTAGGAGGGAGAGGG + Intronic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
953691578 3:45124398-45124420 CCTTCTCTGTCCAAGGAAGATGG + Intronic
954286742 3:49624853-49624875 TCTTCTGGGCAGGAGGAAGAGGG + Intronic
954900948 3:54019053-54019075 CCCTCTGTGAACCAGGAAGAGGG + Intergenic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
956870949 3:73417285-73417307 CCTTATGGGGAGAAGCAAGAGGG - Intronic
958509765 3:95032739-95032761 ACTTCTGTGAAGAAAGATGATGG + Intergenic
958674316 3:97247579-97247601 CATTCTGAGTAGAAGGAACCAGG + Intronic
959548714 3:107629332-107629354 CCTTCTATGTAGAAATAAGTTGG - Intronic
960567116 3:119145848-119145870 ACCTCTGTGAACAAGGAAGAGGG + Intronic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
963765682 3:149333753-149333775 CCTTGTGTTAAGAAGGAAGTTGG + Exonic
966419426 3:179722895-179722917 CCCTCGGTGTAGGAGGAGGAAGG - Intronic
966756689 3:183377992-183378014 CCTTCTCTGAAGAAATAAGATGG + Intronic
967465941 3:189806247-189806269 CCTTCTGTGTAGCTAGAAGCAGG + Intronic
968259040 3:197304290-197304312 CCTTCTCTCTAAAAGAAAGATGG - Intergenic
968466755 4:755688-755710 CCTTGTGTGTAGAATGGACAAGG + Intronic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
969845415 4:9916678-9916700 GCTTCTGTGTTTAAGAAAGAAGG + Intronic
973314394 4:48744925-48744947 GCTTCTGTGTACAAAGAAGGCGG + Intronic
975099750 4:70499290-70499312 CGTTCTGTGAAGAATGATGATGG - Intergenic
976296882 4:83481580-83481602 CCTGCTGTTTAGTAGGAAGATGG - Intronic
976618925 4:87108069-87108091 CCTTTTGAGTAGCAGGAAAATGG + Intronic
977042939 4:92037170-92037192 GCTTCTGTGATGAAGGAAGGCGG - Intergenic
977763224 4:100765372-100765394 ACTTCTGTGAAGAATGATGATGG - Intronic
979418636 4:120475888-120475910 CCTTCTATATAGAAGGATGTTGG - Intergenic
980706108 4:136497970-136497992 CCTTTTGTGTAGGTGGAAAATGG - Intergenic
981223547 4:142265013-142265035 TCTTCTGTGTATAAGCAGGAAGG - Intronic
981522500 4:145678112-145678134 ACTTCTGTGAAGAATGATGATGG + Intergenic
981736352 4:147956366-147956388 CCTCCTGTGTTGCAGGAAGGAGG + Intronic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983467932 4:168118157-168118179 CCTTCTGTGTATAAGGATTGAGG + Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984496609 4:180505999-180506021 CTTTATGTGTAGATGGAAAAGGG - Intergenic
985171550 4:187155305-187155327 CATTCTGTGTATAAATAAGAAGG - Intergenic
986728720 5:10619278-10619300 GCTTGTGTGTTGAAGGAAGGAGG + Intronic
987860255 5:23477179-23477201 CCTTCTGTGTTGTGGGAACATGG + Intergenic
989689661 5:44125944-44125966 AGTTCTGTGGAGAAGGATGATGG - Intergenic
990527160 5:56639232-56639254 CCTTCTAGGTGGAAGGAAGGAGG - Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
992500204 5:77334569-77334591 CCTTTTGTGGAGTAGGAAGTGGG + Intronic
994119947 5:96102257-96102279 CTTTCAGTGTAGAAGGGAGCAGG + Intergenic
995481328 5:112595933-112595955 CCATCAGTGGAGAAGGATGATGG - Intergenic
996561337 5:124832842-124832864 CCTTCTTTCTACAAGGAAAAAGG - Intergenic
997064888 5:130548597-130548619 CCTGCTGTATGGAAGGAATAGGG + Intergenic
998036763 5:138923933-138923955 CCATCTGTGTACCATGAAGAGGG + Intronic
999361017 5:150986905-150986927 ACTTCAGTCTAAAAGGAAGAGGG + Intergenic
999728430 5:154456536-154456558 CCTACTGTGTACAAGGCACAGGG - Exonic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000922670 5:167157165-167157187 CATTCTTTGTACAAGGTAGAAGG - Intergenic
1000964467 5:167639503-167639525 CTTTTTGTGAAGCAGGAAGAAGG - Intronic
1005309191 6:24543039-24543061 TCTTCTGTGTAAAACAAAGATGG - Intergenic
1005620103 6:27612163-27612185 CCTTCTTTGTAGGATGAAAAGGG - Intergenic
1006946148 6:37785611-37785633 GCTGCTGTGTGGGAGGAAGATGG - Intergenic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1007845022 6:44747295-44747317 CCTTCTGAGTGGAAAAAAGAGGG - Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008213315 6:48752972-48752994 TCTTCTGTATAGACTGAAGAAGG - Intergenic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011125988 6:84008394-84008416 CCTTCTGTTTTCAGGGAAGATGG + Intergenic
1012142037 6:95636508-95636530 GCTCCTGGGTAGAAGGAAGTGGG - Intergenic
1013576960 6:111493385-111493407 TCTTCTGTGTAGAAAGAACATGG - Intergenic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1015804012 6:137090338-137090360 CCATCTGTGCACCAGGAAGAGGG + Intergenic
1016062691 6:139646786-139646808 CCTTCTATGAAACAGGAAGAGGG + Intergenic
1016506366 6:144784875-144784897 CCTTCTATGAAAAAGAAAGATGG + Intronic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1018967762 6:168501809-168501831 CCTTCTGTGGGGAATCAAGACGG - Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1020816652 7:12913905-12913927 CCTCCTGTGTAGAACAAGGAAGG - Intergenic
1021517908 7:21507291-21507313 CCTGCTGTGTGGAAGGAATAGGG + Intronic
1021900054 7:25276247-25276269 TCCTCTGTGTCGATGGAAGATGG - Intergenic
1022291238 7:29005640-29005662 ATTTCTGTGTAGGAAGAAGAGGG - Intronic
1022560261 7:31340865-31340887 CCTTCTGTGTTGATGCATGAAGG - Exonic
1022711570 7:32855615-32855637 CCAGCTGAGTGGAAGGAAGAGGG - Intergenic
1022893339 7:34723475-34723497 CTTTCTGTGCAGGAGGAAGGGGG + Intronic
1022913085 7:34919343-34919365 CCAGCTGAGTGGAAGGAAGAGGG + Intergenic
1023963024 7:44943510-44943532 CCATATGTGTAGTAGGGAGAGGG + Intergenic
1024568329 7:50702695-50702717 CATTCTGTGTAGAAGAGAGCTGG - Intronic
1027929402 7:84511645-84511667 CCATCATTGTGGAAGGAAGAGGG - Intergenic
1030123033 7:106129266-106129288 CCCTCTATGTAGCAGCAAGATGG - Intergenic
1030185749 7:106760058-106760080 CCTTTTATTTAGAAGGAAAATGG - Intergenic
1030911806 7:115259433-115259455 CCTGCTGTTTAGGAGAAAGATGG - Intergenic
1031214361 7:118871084-118871106 GCTGCTGTTTAGAAGGAAGAGGG - Intergenic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1034967759 7:155401991-155402013 CCACCTGTGTAGAAAGCAGAAGG + Intergenic
1035644580 8:1209117-1209139 ACTTCTGTGAAGAATGATGATGG - Intergenic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1036616025 8:10388333-10388355 CCCTCTCTGTACCAGGAAGACGG - Intronic
1037256047 8:16955309-16955331 CTTCCTGTGTAGTAGAAAGAGGG - Intergenic
1041019832 8:53627404-53627426 CCATCTGTGAACAAGGAACAGGG + Intergenic
1041785275 8:61625241-61625263 TCTTCAGTGTAGAAAGAAAAAGG + Intronic
1041928206 8:63259655-63259677 GCTTCTGTGCAGTATGAAGAAGG - Intergenic
1042295463 8:67212682-67212704 CCTGCTGTGTGAAAGGAAGATGG + Intronic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1042847880 8:73186469-73186491 CCTTGCGTGTACAAGGAGGAAGG + Intergenic
1043684384 8:83068287-83068309 CCTTCTCTGTAGCAGAAAAAAGG + Intergenic
1045252372 8:100492685-100492707 CCGTCTCTGTGCAAGGAAGAAGG - Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046017439 8:108621789-108621811 CCATCTGTGTAAAATGAGGATGG + Intronic
1046077288 8:109328314-109328336 CCTTCTCTGAAGAAAGAAAAAGG + Intronic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG + Intergenic
1048131187 8:131699483-131699505 CTTTTTGTGTAGACGTAAGAAGG - Intergenic
1048492678 8:134908840-134908862 AGTTCTGTGTAGAATGATGATGG + Intergenic
1050687064 9:8183759-8183781 CCATCTGTGAACAAGGAAGCAGG - Intergenic
1053791564 9:41689860-41689882 CCTTCTGAGTAGCAGGACTATGG - Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054153593 9:61624910-61624932 CCTTCTGAGTAGCAGGACTATGG + Intergenic
1054179970 9:61901875-61901897 CCTTCTGAGTAGCAGGACTATGG - Intergenic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1054657623 9:67679266-67679288 CCTTCTGAGTAGCAGGACTATGG + Intergenic
1055293260 9:74806611-74806633 CCCTCTGTGTATCAGGAACATGG + Intronic
1055475059 9:76654816-76654838 CCTACAGTGTGGTAGGAAGAAGG - Intronic
1055685458 9:78768871-78768893 CCTTAGGTGTAGAAGCAATAGGG - Intergenic
1056217496 9:84418866-84418888 CCATCTGTGAACAAGGAAAAGGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1059620411 9:115998478-115998500 CCTTCTGTGTAAAATGAGAATGG + Intergenic
1060015241 9:120081038-120081060 TGTTCTGTGTAGGGGGAAGAAGG + Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060944491 9:127561917-127561939 ACTTCTGTGCTGGAGGAAGAAGG - Intronic
1186816258 X:13240872-13240894 CCATCTCTGTAGAGGGAAGTGGG + Intergenic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1190597886 X:52065248-52065270 CCTTCAGTGAAGCAGGAAGACGG - Intronic
1190610938 X:52188825-52188847 CCTTCAGTGAAGCAGGAAGACGG + Intronic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1191770082 X:64745969-64745991 ACTTCTGTGAAGAATGATGATGG + Intergenic
1193047659 X:77069500-77069522 CCTGCGGTTTAGAAGGAATAGGG - Intergenic
1194554386 X:95338987-95339009 ACTTCTGTGAAGAATGATGATGG - Intergenic
1194581232 X:95674299-95674321 GCTTCTCTCTAGAAAGAAGAAGG - Intergenic
1195389979 X:104351418-104351440 CGCTCTGTATAGAAGGAGGAAGG - Intergenic
1196622438 X:117839085-117839107 AGTGCTGTGGAGAAGGAAGAAGG + Intergenic
1197878780 X:131142347-131142369 ACTTCTGTGAAGAATGATGACGG - Intergenic
1198267837 X:135026693-135026715 ACTTCTGTGAAGAATGATGAGGG - Intergenic
1199130156 X:144175667-144175689 CCTTCTGCATACTAGGAAGAAGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1201184498 Y:11386572-11386594 GATTATGTGTAGAAGGTAGAGGG + Intergenic