ID: 954991884

View in Genome Browser
Species Human (GRCh38)
Location 3:54848424-54848446
Sequence CAGAATATGGGGCATTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954991884 Original CRISPR CAGAATATGGGGCATTTGTT TGG (reversed) Intronic
904324724 1:29720973-29720995 TAGAAGATGGGGCATTTGGGAGG - Intergenic
910902771 1:92140124-92140146 AAGAATATAGGGCATTTGCCAGG + Intronic
914886028 1:151585081-151585103 GGGAAGATGGGGCAGTTGTTCGG - Intergenic
915236329 1:154485809-154485831 GAAAATAAGAGGCATTTGTTTGG - Intronic
917951886 1:180046990-180047012 CAGAATATAATGCAATTGTTTGG - Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
922169639 1:223143653-223143675 CAGAATCTGCTGCATATGTTTGG + Intergenic
1063609519 10:7551464-7551486 GGAAATATGGGGCATTTGTGAGG + Intergenic
1063696555 10:8341184-8341206 TAGAATATGGTACCTTTGTTAGG + Intergenic
1063720630 10:8577401-8577423 CAGAAAATGTGGCAATTCTTTGG + Intergenic
1063756235 10:9012319-9012341 TAAAATATGGGGCAAATGTTTGG - Intergenic
1063945529 10:11172534-11172556 CAGAGTATGGGGCATTTAAAGGG - Intronic
1064841523 10:19597612-19597634 CATAATATGTGGCATCAGTTAGG - Intronic
1064882271 10:20069338-20069360 GAGAATATGGGGAATTGCTTAGG + Intronic
1069029902 10:63584408-63584430 AAAAAGATGGGGCATGTGTTGGG - Intronic
1075394552 10:122117552-122117574 ACGAATATGGGGCTCTTGTTAGG + Intronic
1077972528 11:7209822-7209844 CATAAAATGGGAAATTTGTTTGG + Intergenic
1079264829 11:18921140-18921162 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079267004 11:18943287-18943309 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079799813 11:24854712-24854734 CACAAAATGGGGCAGTTGTTTGG - Intronic
1083835076 11:65261385-65261407 CTGAATCTGGGGCATTTGGGGGG - Intergenic
1084196909 11:67528132-67528154 AAGAATATAGGACCTTTGTTGGG - Intergenic
1085295187 11:75427486-75427508 CAACATGTGGGGCCTTTGTTGGG - Intronic
1087970489 11:104475237-104475259 CACAACATGTGGCATTTTTTGGG - Intergenic
1090223333 11:125050710-125050732 CAGAATATGGGTCATTTTGTAGG + Intergenic
1092500535 12:9041949-9041971 TAAAATATGTGGCATTGGTTTGG + Intergenic
1097577394 12:61412139-61412161 CAGAATATGGAGTATTTATAGGG - Intergenic
1097965043 12:65570298-65570320 CAGGATATGGGGCATGTGATTGG - Intergenic
1099349324 12:81545496-81545518 AGGAATATTGGGTATTTGTTTGG - Intronic
1102998302 12:117366223-117366245 CAGACCAAGGGGCATTTCTTGGG - Intronic
1103181584 12:118916768-118916790 CAGAATATGGCGAATATGTTGGG + Intergenic
1103713245 12:122928689-122928711 AAGAACAGGTGGCATTTGTTGGG + Intronic
1109498465 13:63207518-63207540 AAGAATATAGGGCTGTTGTTTGG + Intergenic
1109870277 13:68323804-68323826 CAAAAGATGAGGAATTTGTTGGG - Intergenic
1111282718 13:86048568-86048590 GAGAATATGGTGTATTAGTTAGG + Intergenic
1111614493 13:90645361-90645383 CAGACAATGAGGCATTAGTTAGG - Intergenic
1114184811 14:20392535-20392557 CAGAATATGGGATATTCTTTGGG + Intronic
1114385982 14:22255255-22255277 CAGAATGTTGGGTATTTATTTGG + Intergenic
1115731676 14:36276052-36276074 AATAGTATGGGGCATTTTTTGGG - Intergenic
1116233467 14:42248026-42248048 GAGAATAAGGGGCATTGCTTTGG - Intergenic
1120825366 14:88950157-88950179 AAGAATATTGGGAATGTGTTTGG + Intergenic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126360775 15:47843577-47843599 GAGACAAGGGGGCATTTGTTGGG - Intergenic
1126522345 15:49609803-49609825 CAGAATATGGGTATTTGGTTGGG + Intronic
1127518148 15:59716142-59716164 CTGAATATGGTGCATTTATGAGG - Intergenic
1129024496 15:72557438-72557460 CTGGATATGAGGCTTTTGTTGGG + Intronic
1130262370 15:82366207-82366229 AAGAATATGGATCATTTATTTGG + Intergenic
1130278858 15:82502800-82502822 AAGAATATGGATCATTTATTTGG - Intergenic
1134901454 16:17941670-17941692 AATAATATGGGGCATTTGTTTGG + Intergenic
1137303671 16:47179780-47179802 TAGTATATGGGGAATTTGTGAGG + Intronic
1140768325 16:78180521-78180543 GAGAGTAAGGGGCATATGTTAGG + Intronic
1140768373 16:78180763-78180785 GAGAGTAGGGGGCATATGTTAGG + Intronic
1146801494 17:35827375-35827397 AAGAATATCTGGCATTAGTTGGG + Intronic
1148888692 17:50792165-50792187 CGGAATTTGGGGTATTGGTTAGG + Intergenic
1149804477 17:59602263-59602285 CTGAAGTTGGGGCAGTTGTTGGG + Intronic
1150502985 17:65668925-65668947 GACAATATGGGGCATTAGATGGG - Intronic
1155527030 18:26727631-26727653 CATAATATGGGGCATCAGGTAGG - Intergenic
927616302 2:24600155-24600177 CAAAGTATTGGGCATTTCTTGGG + Intronic
931609781 2:64086675-64086697 CAGAATTTGGAGGATTTCTTTGG + Intergenic
931915180 2:66946790-66946812 CTGAATGGGGGGCAGTTGTTTGG + Intergenic
932326553 2:70866047-70866069 CACAATGTATGGCATTTGTTTGG + Intergenic
935798081 2:106664565-106664587 AAGACTTTGGGGCACTTGTTGGG + Intergenic
936547353 2:113404142-113404164 CAGGATATGCTGCATTTGTGTGG + Intergenic
939359624 2:141152460-141152482 CAGAATATTTGTCATTTGTTAGG - Intronic
941005418 2:160242182-160242204 CACAATGTGGGGCATGTGGTAGG + Intronic
943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG + Intronic
946245433 2:218384519-218384541 CAGAAGGTGGGGCATTTGTGTGG + Intronic
948917435 2:241042006-241042028 CAGAATCTGGGGCAATTGTAGGG - Intronic
1172995170 20:39064987-39065009 CAGAGTATGGGAGATTAGTTTGG + Intergenic
1178465858 21:32847079-32847101 TACAAAATGGGGCATTTGTGTGG - Intergenic
1178879173 21:36434949-36434971 CAGAATATGGGGGACTTGGCAGG - Intergenic
1179073228 21:38092835-38092857 CTTAATATGTGGCATTTATTTGG - Intronic
1179404247 21:41112183-41112205 TAGAAAATGGGGCATTTGCCGGG + Intergenic
1181597237 22:23924015-23924037 CAGATTGTGGGGCATTTGCCTGG - Intergenic
1181847410 22:25722804-25722826 CAGAATATGTGGCAATGCTTAGG - Exonic
1184632325 22:45792510-45792532 CAGAAAAGGGGACATTTCTTGGG - Intronic
952189824 3:31010769-31010791 CAGAATATTGGGAATTTTTGAGG + Intergenic
954198822 3:49012279-49012301 CAGAATATTGGGCACTGCTTTGG + Exonic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
956168698 3:66415870-66415892 CAGAAAAAGCAGCATTTGTTTGG - Intronic
957186252 3:76945395-76945417 TAAAATTTAGGGCATTTGTTAGG + Intronic
958066242 3:88547140-88547162 CAGAATATGAGGCACATATTAGG + Intergenic
960684669 3:120284916-120284938 CAGAATCTGGGCAGTTTGTTTGG - Intronic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
961942196 3:130649641-130649663 CAAAATCAGGGCCATTTGTTAGG + Intronic
962750279 3:138430006-138430028 CAGAATCTCTAGCATTTGTTTGG - Intergenic
965702364 3:171471106-171471128 CAGTATATGGGGAATCTGGTGGG - Intergenic
971292342 4:25355546-25355568 CTTAATATGGGACACTTGTTTGG + Intronic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
971511600 4:27433394-27433416 CTGAATATGGGCCATCTGTGAGG - Intergenic
973038391 4:45437778-45437800 CCGTATATGGGGCATATGTAAGG + Intergenic
973608980 4:52616083-52616105 AAGAATATTTGGCAGTTGTTGGG - Intronic
974251813 4:59394586-59394608 CACAAAATGGGGCAGCTGTTTGG - Intergenic
975225472 4:71866292-71866314 CTGAAGATGGGGCCTTTGGTAGG + Intergenic
977076139 4:92453027-92453049 ATGAATATGTGGCATTTGTGTGG + Intronic
978704576 4:111691534-111691556 CTGAATGTTGGGCATATGTTAGG - Intergenic
978704712 4:111692791-111692813 CAGATTATCAGGCATTAGTTAGG - Intergenic
979391991 4:120138779-120138801 CAGAAGATGGGGAACTTGTTGGG - Intergenic
979652107 4:123146942-123146964 AGGAGTATGGGGCATTTGTTGGG - Intronic
982797985 4:159668439-159668461 AAGATAATGGGGAATTTGTTGGG + Intergenic
983346905 4:166538534-166538556 TAAAATATGTGGCATTGGTTTGG - Intergenic
984511361 4:180682861-180682883 GACAATATGGAGCATATGTTGGG + Intergenic
988583302 5:32487462-32487484 CAGAATATGGAGCACATTTTTGG + Intergenic
989442380 5:41488161-41488183 GAGAATATGCGGTGTTTGTTTGG + Intronic
997143437 5:131407112-131407134 CATAAAATGGGGGATTTGTAAGG - Intergenic
998495712 5:142587579-142587601 CAGAAGAAGGGGCATTTCTTTGG + Intergenic
1000343958 5:160298842-160298864 CAGAATATAGGACATTTATCAGG + Intronic
1003346709 6:5275671-5275693 CAGATTCTGTTGCATTTGTTTGG + Intronic
1014122262 6:117739000-117739022 CAAAATAAGGGCCATTTCTTCGG + Intergenic
1014196907 6:118571489-118571511 CAGAAGATTGGGATTTTGTTTGG - Intronic
1014281896 6:119450739-119450761 CAGAATATGGATCAGATGTTTGG + Intergenic
1015463183 6:133517127-133517149 GAGAACATGCGGCATTTGGTGGG - Intronic
1016306550 6:142690457-142690479 GAGAACATGCAGCATTTGTTTGG + Intergenic
1017203055 6:151776304-151776326 CAGAATAGGAGGGATTTGTGGGG + Intronic
1026451633 7:70534366-70534388 CAGAATATCGGGGAGTTATTGGG + Intronic
1027470199 7:78564167-78564189 CAGATTATGAGGCAGTTGTGCGG - Intronic
1027470507 7:78567794-78567816 CAGAGAATTGGGTATTTGTTGGG - Intronic
1030771553 7:113481904-113481926 TAGAAGATAGGGCATTTGTTAGG + Intergenic
1030800312 7:113842075-113842097 CAAAATATGGGTGACTTGTTAGG - Intergenic
1041749255 8:61241101-61241123 CAGAAAGTGGGGCTTTTGCTAGG - Intronic
1042414498 8:68503580-68503602 GAGAATATTGGGCACCTGTTGGG + Intronic
1043996754 8:86827065-86827087 CTGCATATGGTGCATTTGATTGG + Intergenic
1044751540 8:95421239-95421261 AAGAGTTTGGGGCATATGTTTGG + Intergenic
1046173918 8:110549837-110549859 CAGAATATGTAGCATTTTATAGG + Intergenic
1046309977 8:112422704-112422726 CAGAATATGGTGTATTTGTTGGG - Intronic
1053026017 9:34728996-34729018 CTGAATATGGGGGATTTTTCCGG - Intronic
1053037521 9:34838045-34838067 CACAATATGGGGGATTTTTTTGG - Intergenic
1053276547 9:36787691-36787713 AAGGATATGGGGCAATGGTTGGG + Intergenic
1055897151 9:81191250-81191272 CAAAATATAGGTTATTTGTTTGG - Intergenic
1056235577 9:84590586-84590608 TATAAAATGGAGCATTTGTTTGG + Intergenic
1057719110 9:97518081-97518103 GAGAAGATGGGGCAGGTGTTGGG - Intronic
1061140868 9:128765688-128765710 CTGTAAATAGGGCATTTGTTTGG - Intronic
1061350499 9:130060726-130060748 CAGAAATTTGGGCATTTCTTGGG + Intronic
1061457753 9:130711756-130711778 CAGAACATGGATTATTTGTTAGG + Intergenic
1187592683 X:20735630-20735652 CAGAGTAACTGGCATTTGTTAGG + Intergenic
1191181024 X:57563993-57564015 CAGTATATTTTGCATTTGTTGGG - Intergenic
1191799955 X:65067224-65067246 CACAAAATGGGGCAGCTGTTTGG - Intergenic
1191802674 X:65098790-65098812 CACAAAATGGGGCAGCTGTTTGG + Intergenic
1193909885 X:87291027-87291049 CAGAATAGGGGATATTTGATGGG - Intergenic
1195926727 X:110033635-110033657 GTGAATATGGGCCATCTGTTTGG - Intronic
1196512731 X:116531339-116531361 TAGAAGATGGGGCATTTGGGAGG + Intergenic
1200016150 X:153165094-153165116 AAGAATGGGGGACATTTGTTTGG + Intergenic
1200304118 X:155007729-155007751 CAGATCATGCGGCATTAGTTAGG - Intronic