ID: 954992649

View in Genome Browser
Species Human (GRCh38)
Location 3:54854546-54854568
Sequence TGTGCTTATGAATCCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954992646_954992649 5 Left 954992646 3:54854518-54854540 CCACAGGTATTTTTTTTATTATG 0: 1
1: 0
2: 3
3: 88
4: 1253
Right 954992649 3:54854546-54854568 TGTGCTTATGAATCCCCTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 149
954992645_954992649 6 Left 954992645 3:54854517-54854539 CCCACAGGTATTTTTTTTATTAT 0: 1
1: 0
2: 13
3: 205
4: 1940
Right 954992649 3:54854546-54854568 TGTGCTTATGAATCCCCTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954992649 Original CRISPR TGTGCTTATGAATCCCCTTT GGG Intronic