ID: 954992830

View in Genome Browser
Species Human (GRCh38)
Location 3:54855754-54855776
Sequence TTAATCACTTGAGCAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954992830_954992834 -3 Left 954992830 3:54855754-54855776 CCCCCTTCTGCTCAAGTGATTAA 0: 1
1: 0
2: 0
3: 15
4: 138
Right 954992834 3:54855774-54855796 TAAGAATTGTTATCTGTTGCTGG 0: 1
1: 0
2: 1
3: 24
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954992830 Original CRISPR TTAATCACTTGAGCAGAAGG GGG (reversed) Intronic