ID: 954993642

View in Genome Browser
Species Human (GRCh38)
Location 3:54862427-54862449
Sequence AAGGCTCAGCATTCTGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954993642 Original CRISPR AAGGCTCAGCATTCTGACGT TGG Intronic
904196686 1:28790934-28790956 AAGTCTCAGCTTCCTCACGTGGG + Intergenic
912203547 1:107484799-107484821 AAGACCCAGCATTCTGAAATGGG + Intergenic
912631358 1:111249095-111249117 AAGGCTAAACATTCTGCTGTTGG - Intergenic
914417704 1:147499166-147499188 AAGGCTGAGCATTCTGCAGTTGG + Intergenic
914916767 1:151823879-151823901 AAGCCTCAGCCTCCTGAAGTGGG + Intronic
917294610 1:173505651-173505673 AAGGCTCAGCATTCCCAGGATGG + Intronic
920183747 1:204148074-204148096 AAGCCTCAGCAGGCTGAGGTTGG + Intronic
1062807329 10:433053-433075 AATGTTCAGCATTCTGTTGTTGG + Intronic
1064301526 10:14127193-14127215 AAGGCTCAGCATTCAGGTGGAGG + Intronic
1067727625 10:48782725-48782747 AAGGCTCAGCATTTTGAGAAGGG - Intronic
1067746998 10:48943511-48943533 GAGGCTCTGCATGCTGACTTAGG - Intronic
1069982775 10:72263879-72263901 AAGGCTCAGCATGCAGACCTGGG + Intergenic
1075640198 10:124059176-124059198 AAGGCTCAGCATTGTTCCATGGG + Intronic
1076479340 10:130774680-130774702 AAGGCTCAGCATGATTAGGTAGG + Intergenic
1078298588 11:10101287-10101309 AAGGCTCAGCTTTCTCCTGTTGG - Intronic
1079492375 11:21003179-21003201 AAGACTGAGCATCCTGAAGTTGG - Intronic
1079944602 11:26726083-26726105 AAAGCTCAACCTTCTGACTTTGG - Intergenic
1081742445 11:45449980-45450002 AGGGCTCAGCATCCTCACATGGG - Intergenic
1085035913 11:73299918-73299940 CAGGCCCATCGTTCTGACGTGGG + Intergenic
1086335833 11:85799926-85799948 AAGGGTCAGCATGCTGTAGTGGG - Intronic
1090729518 11:129557855-129557877 ACTTCTCAGCATTCTGAGGTTGG - Intergenic
1092273222 12:7039444-7039466 AAGGCTGAGCCTTCTGCCCTCGG + Intronic
1095468980 12:42516773-42516795 AAAGCTAAGAATTCTGACTTTGG - Intronic
1101249077 12:102914612-102914634 AAGGCTCAGTATTCTTTAGTAGG - Intronic
1105497736 13:20945515-20945537 AGGGCTCAGCATTCTCAGTTCGG - Intergenic
1106022361 13:25927412-25927434 AAAGCTCAGAATTCTGACACAGG - Intronic
1113327673 13:109298114-109298136 AAGGCTCAGCAAACTGCAGTCGG + Intergenic
1113738473 13:112694533-112694555 AAGGCTGAGCATCCCGGCGTGGG + Intronic
1114212595 14:20627908-20627930 TAGGGTCAGCATTCCGAAGTAGG - Intergenic
1118102133 14:62618606-62618628 AATGCTCAGGTTTCTGACTTGGG - Intergenic
1119530783 14:75359699-75359721 AAAGCTCAGCACTCTGGGGTGGG + Intergenic
1121545693 14:94761826-94761848 AAGACTCAGCGTTCTGGAGTTGG - Intergenic
1121717611 14:96087463-96087485 AAGAAACAGCATTCTCACGTGGG - Exonic
1122689636 14:103526017-103526039 AACCCTCAGCTTTCTGAGGTGGG + Intergenic
1128176280 15:65558893-65558915 AAAGGTAAGGATTCTGACGTGGG - Intronic
1129882073 15:79013653-79013675 CAGGCTCAGAATTCAGAGGTGGG + Intronic
1130287497 15:82568126-82568148 AAGGCTCAGAATTCTAACCCAGG - Intronic
1131674132 15:94654121-94654143 AATGCTCAGCATTTTGAGGTCGG + Intergenic
1132209065 15:100007198-100007220 GGGGCTCAGCATTCAGACGGAGG + Intronic
1132576472 16:666645-666667 AAGGCGCAGCATGCTGCGGTGGG - Intronic
1135375619 16:21944415-21944437 AAGGCTCAGTTTTCTTACATTGG + Intergenic
1135800461 16:25489310-25489332 AAGGCTCATCATACTGCTGTAGG - Intergenic
1138719601 16:59064097-59064119 AAGGCAAAGCATTCAGACTTGGG + Intergenic
1139210153 16:65069198-65069220 AAGTCACAGCATTGTGACTTTGG - Intronic
1142750505 17:1984600-1984622 AAGGATCAGAATTCTCAAGTTGG - Intronic
1143993331 17:10985835-10985857 ATGGATCAGCATCCTGACTTTGG + Intergenic
1146658366 17:34648633-34648655 GAGGCTCATCATCCTGAGGTAGG - Intergenic
1152539787 17:80969158-80969180 AATGCTCAGCCTTCTGGCGAGGG + Intergenic
1156550005 18:38005353-38005375 AAGGCCCAGCATTCAAAGGTGGG + Intergenic
1157952956 18:52060882-52060904 TAGTCTGAGCATTCTGAGGTGGG - Intergenic
1161263933 19:3354269-3354291 ATGGCTCAGGAGTCTGAAGTGGG + Intergenic
1162159622 19:8702129-8702151 AAGGCACAGCAGGCTGACCTAGG - Intergenic
1164676956 19:30107335-30107357 AAGCCCCAGCATCCTGGCGTTGG - Intergenic
925211554 2:2052349-2052371 AAGGATCAGCTTCCTGACATTGG + Intronic
935789518 2:106578030-106578052 AAGGCTCAGGTTTCTGACTTGGG - Intergenic
941602247 2:167558000-167558022 AAGGCTGAGCATTCTGAAGCAGG - Intergenic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
947464189 2:230326625-230326647 AATGCTCAGCATTATAACCTGGG - Intergenic
947473095 2:230415667-230415689 AATGCTCAGCATTATAACCTGGG - Intergenic
948517467 2:238512777-238512799 AAGGCTCAGCAAACTGCCTTTGG - Intergenic
1173850216 20:46213107-46213129 AAGGCTGAGGACTCAGACGTGGG - Exonic
1174035219 20:47664537-47664559 AAGCCTCAGCATCTTGAGGTTGG + Intronic
1185380948 22:50507369-50507391 AAGGCTCTGGACTCTGACCTGGG - Intronic
954993642 3:54862427-54862449 AAGGCTCAGCATTCTGACGTTGG + Intronic
956199361 3:66690417-66690439 AATACCCAGCATTCTGATGTAGG + Intergenic
958954850 3:100456444-100456466 AAGCTTCAGCACTCTGAGGTGGG + Intergenic
961648142 3:128403563-128403585 CAGGCTCCCCATTCTGACTTGGG - Intronic
962404760 3:135091435-135091457 AAGTCTCAGCACTCTGCTGTGGG + Intronic
964789063 3:160434116-160434138 AAGGCTCAGCATACCTTCGTGGG + Exonic
966356272 3:179082543-179082565 ATGTCTCAGTAGTCTGACGTTGG + Intergenic
970361960 4:15318783-15318805 AAGGCACAGAATACTGAAGTTGG + Intergenic
973232597 4:47859400-47859422 AATACTCAGCACTCTGAAGTGGG + Intronic
974676045 4:65090509-65090531 ATGGCTCAGAATTCTGATCTGGG + Intergenic
990881559 5:60544625-60544647 AAGCCTCAGCCTTCTTATGTTGG - Intergenic
996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG + Intronic
996688847 5:126315572-126315594 AAGTCTCATCATTCTGACAAGGG - Intergenic
998327288 5:141292538-141292560 AAGGCTCAGCATTCTTCTGCTGG - Intergenic
998348536 5:141485639-141485661 AAGGCTCAGGATGCAGATGTGGG + Exonic
998553703 5:143102472-143102494 GAGGATCAGCATTCTGAGTTAGG - Intronic
998951811 5:147400484-147400506 AAGGCCTAGCATTCTGAAGGAGG - Intronic
1001680042 5:173549893-173549915 TAGGCTGAGGACTCTGACGTGGG - Intergenic
1003816816 6:9851111-9851133 AAGGCTCTGCATCCTGCCCTGGG + Intronic
1003900190 6:10647764-10647786 ATGGGTCAGAAGTCTGACGTGGG + Intergenic
1004852243 6:19712166-19712188 AGGGCTCAGCATCCTGGCTTAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006107709 6:31726647-31726669 AAGGGTCAGTCTCCTGACGTTGG - Intronic
1006669869 6:35723381-35723403 AAGGCTGAGCAATCTGACACTGG + Intronic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1024137713 7:46427609-46427631 AAGGCAAAACATTCTGAGGTGGG + Intergenic
1025936872 7:66044566-66044588 AACGCTCAGCAGTCTGAAGTCGG - Intergenic
1033433068 7:141306796-141306818 AAGGCCAAGCAGTGTGACGTAGG - Intronic
1037477312 8:19270346-19270368 AAGGCTCAGCATGATGATGAAGG + Intergenic
1037897865 8:22670127-22670149 AAGGCCCTGAATTCTGACTTTGG - Intergenic
1041706840 8:60855481-60855503 AAAGTTCAGCATTATGAAGTGGG - Intronic
1042814752 8:72866141-72866163 TATGCTGAGCATTCTGACTTTGG + Intronic
1043731464 8:83688884-83688906 AAGCCTAAGCATTCTGATATGGG + Intergenic
1043890274 8:85645976-85645998 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043891890 8:85658166-85658188 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043894214 8:85724531-85724553 AAGTCTCACCATTCTGTCCTGGG + Intergenic
1043894570 8:85727616-85727638 AAGTCTCACCATTCTGTCCTGGG + Intergenic
1043894926 8:85730701-85730723 AAGTCTCACCATTCTGTCCTGGG + Intergenic
1043895282 8:85733786-85733808 AAGTCTCACCATTCTGTCCTGGG + Intergenic
1043897394 8:85748022-85748044 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043897750 8:85751110-85751132 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043898106 8:85754195-85754217 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043899720 8:85766390-85766412 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043901327 8:85778583-85778605 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043901682 8:85781668-85781690 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043903292 8:85793858-85793880 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043904903 8:85806051-85806073 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043906514 8:85818242-85818264 AAGTCTCACCATTCTGTCCTGGG - Intergenic
1043932293 8:86104947-86104969 AAGGCAAAACATTCTGACGAAGG - Intronic
1048366471 8:133742937-133742959 AAGTGTCAGCATTCTGAGATGGG - Intergenic
1057051669 9:91928473-91928495 AAGGTACACCACTCTGACGTGGG + Intronic
1057873638 9:98736421-98736443 AAGGCACAGCAGTGTGACGGGGG + Exonic
1192810439 X:74542517-74542539 AAGGCTCAGCATACCGTCTTGGG + Intergenic