ID: 954994507

View in Genome Browser
Species Human (GRCh38)
Location 3:54869355-54869377
Sequence TTAAAGAAGCAGAATTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 573}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954994505_954994507 6 Left 954994505 3:54869326-54869348 CCAAATGCATTATGGGCAATAAA 0: 1
1: 0
2: 1
3: 11
4: 214
Right 954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG 0: 1
1: 0
2: 1
3: 49
4: 573
954994501_954994507 15 Left 954994501 3:54869317-54869339 CCTGTTTTCCCAAATGCATTATG 0: 1
1: 1
2: 0
3: 31
4: 292
Right 954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG 0: 1
1: 0
2: 1
3: 49
4: 573
954994504_954994507 7 Left 954994504 3:54869325-54869347 CCCAAATGCATTATGGGCAATAA 0: 1
1: 0
2: 0
3: 20
4: 188
Right 954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG 0: 1
1: 0
2: 1
3: 49
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954994507 Original CRISPR TTAAAGAAGCAGAATTAAGA AGG Intronic
900007996 1:77432-77454 TTAAATAAGCATACTTAAAATGG + Intergenic
900727487 1:4226623-4226645 TAATGGATGCAGAATTAAGAAGG - Intergenic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
900865940 1:5268771-5268793 TCACAGCAGCAGACTTAAGAGGG + Intergenic
901569224 1:10146070-10146092 TTCAAGATGCACAATTAACAAGG + Intronic
901909304 1:12441868-12441890 AAAAAGAAGCAAAATAAAGATGG - Intronic
901909404 1:12443516-12443538 AAAAAGAAGCAAAATAAAGATGG - Intronic
902882213 1:19379824-19379846 AGAAAGTAGCAGAATTAAAAAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904912399 1:33945149-33945171 TTAAAGAAGCACCACCAAGAAGG + Intronic
905467322 1:38165103-38165125 TTTAAGAACCAGAATCAATAGGG - Intergenic
907040906 1:51258316-51258338 TTAAAGATGCAGAAATAGGTTGG + Intronic
907827393 1:58032049-58032071 TTTGAGAAGCAGAGTTTAGAAGG - Intronic
907845470 1:58201950-58201972 TGATAGAAGCAGAATTAGGTAGG - Intronic
907873492 1:58464485-58464507 ATAAAGCAGCATAAATAAGATGG + Intronic
908929562 1:69302750-69302772 TTCAAGAAGTAGAATTAACAGGG + Intergenic
908967691 1:69786455-69786477 TGAAAGAAGAAAAAATAAGAGGG - Intronic
909572252 1:77128242-77128264 TTAAAGAAGCACAAGAAAGATGG + Intronic
909869457 1:80721392-80721414 TTGCATAAGCAGTATTAAGAGGG - Intergenic
909929824 1:81484226-81484248 TTAAACAATTAGAATTAATAAGG - Intronic
910015983 1:82524517-82524539 TTAAAGAAGCCAAATGAAAAAGG + Intergenic
910022457 1:82608744-82608766 ATAAATAAGTAGAATTAAGTAGG - Intergenic
910108102 1:83653225-83653247 TTTAAAAAGCAGAGTTGAGAAGG - Intergenic
910165036 1:84318258-84318280 AAACAGAAGCAGTATTAAGAGGG - Intronic
910272840 1:85415795-85415817 TTAAAAAATCAAAATTTAGAAGG - Intronic
910720895 1:90285221-90285243 TCACAGAAGCAGAATTTGGAGGG + Intergenic
910797915 1:91117225-91117247 TTAAAGAACCTCAATTCAGAGGG - Intergenic
911194654 1:94981708-94981730 TTAAAGAAGCAGAGGTTAGAGGG + Exonic
911624077 1:100100947-100100969 TTAAAGAATCAGACTAAAAATGG - Intronic
911625421 1:100118320-100118342 AAAAAAAAGAAGAATTAAGAAGG + Intronic
911719147 1:101171127-101171149 CTAAAAAATCAGAAATAAGAAGG + Intergenic
911882244 1:103254704-103254726 TTAAAGAAGTAGTATAGAGAGGG - Intergenic
912112449 1:106359607-106359629 ACAAATAAGCAGAATTAAGATGG + Intergenic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
913160475 1:116140654-116140676 TTAAAGAAGAATAATAAAGCAGG + Intergenic
914870867 1:151472823-151472845 TTTGACAAGCAGTATTAAGAAGG - Intergenic
915358467 1:155271071-155271093 AAAAAGAGGCAGAAATAAGAGGG - Intronic
915776524 1:158494333-158494355 TTATAGAAGCAAAAATAAAAAGG + Intergenic
915786414 1:158617807-158617829 TTTAAGAAGAATAATTAAGAGGG - Intronic
916396587 1:164395749-164395771 TTAAAGAAGTAAAATTAATAAGG + Intergenic
917353860 1:174105890-174105912 TTAAAGAAGGAAAATCAAGGAGG - Intergenic
918724691 1:187905066-187905088 TTAAGAAACTAGAATTAAGATGG + Intergenic
918943288 1:191028028-191028050 TTAAAGAAGTAGGCTTCAGAAGG + Intergenic
919511079 1:198464992-198465014 TTAATGAAGCTGATTTTAGAAGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
921940914 1:220838739-220838761 TCATAGAAGCAGAATTAATTGGG - Intergenic
922365536 1:224860040-224860062 AAAAAGAAACACAATTAAGAAGG - Intergenic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
924013571 1:239694427-239694449 TTAAAGATTCAGAACTTAGAGGG - Intronic
924214270 1:241804357-241804379 TTGAAGAAGAAGAATAAAGTTGG + Intergenic
924259202 1:242212274-242212296 TTAAGCAAGCAGCATTAAAAGGG + Intronic
924462538 1:244272212-244272234 CTAAGGAAGCATAATTCAGAAGG - Intergenic
924514768 1:244756671-244756693 TGAAAGAAAGAGAATTCAGAGGG + Intergenic
924634078 1:245768274-245768296 TTAAACAAGCAGAGAAAAGAAGG + Intronic
1062785111 10:258164-258186 TTACAGAGGCAGAATGAAGGAGG + Intergenic
1063191514 10:3698881-3698903 TTAAAGCAGCAGGAGTTAGATGG - Intergenic
1063334717 10:5200237-5200259 ATAAATAAGCAGAATCAATATGG - Exonic
1063732418 10:8713199-8713221 TGAAAGAAGTAGAGTTTAGAAGG + Intergenic
1065267063 10:23987398-23987420 TTAAAAAAACAAAAGTAAGAAGG - Intronic
1066366313 10:34780108-34780130 CAAAAGAAGCAGAGTTAAAATGG - Intronic
1066683107 10:37954705-37954727 TTAAAGATGCATAAATATGAAGG - Intronic
1066935060 10:41818655-41818677 ACAAAGAAGCAGAGTCAAGATGG - Intergenic
1067242191 10:44506480-44506502 TAAAAGAAGGACAATTTAGAGGG - Intergenic
1068066772 10:52141797-52141819 TTTAAGAAGGAGAAGTAAAAGGG + Intronic
1068399695 10:56512005-56512027 TAAAAGAGGCAAAATAAAGAGGG + Intergenic
1069295293 10:66836338-66836360 ACAAGGAAGCAGAATTAAGATGG - Intronic
1069611643 10:69776637-69776659 GTTAAGAAGCAGAATTGAAAAGG + Intergenic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1071661471 10:87506294-87506316 TTAGAGAAAGACAATTAAGAAGG - Intronic
1071910365 10:90225011-90225033 TGAATGAAGCAGAATGAAGAAGG - Intergenic
1072157502 10:92737271-92737293 TTAAAGAAGGAGAATATAGCAGG + Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1073702908 10:105950114-105950136 TTAAAGATTCAGAATCAAGTAGG - Intergenic
1074660466 10:115649901-115649923 TAAAAGAAGCAGACTTAAAGTGG + Intronic
1074728180 10:116337057-116337079 TGAGAGAAGCAGAATTAACCAGG + Intronic
1077128904 11:959443-959465 GTAAAGAAGCAGAAATAAAAAGG + Exonic
1077661952 11:4077100-4077122 ATAAAGCAGCAAAATTAAGCAGG + Intronic
1077864847 11:6213717-6213739 TTAATGAGGCAGAAATGAGAAGG - Intronic
1078416118 11:11167324-11167346 TGAAAGAAGCAGGACTCAGAAGG + Intergenic
1078975362 11:16468543-16468565 TTAAAGAAGCAGAACTCATAAGG - Intronic
1079619282 11:22533704-22533726 AGAAAGAAGCATAATTTAGAAGG - Intergenic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1079850423 11:25526425-25526447 TCAAAGAGGCAGAATGGAGAAGG + Intergenic
1080222722 11:29924622-29924644 ATAATGAGGCAGAACTAAGATGG + Intergenic
1080714014 11:34780611-34780633 TTAAAGAAGAAGAGGAAAGATGG - Intergenic
1084999952 11:73023886-73023908 TCAAAGAAGCCAAATTAAAAAGG + Intronic
1086517996 11:87636232-87636254 TTAATGCAGCAGAATGACGATGG - Intergenic
1086821312 11:91439450-91439472 TTCAGGATGCAAAATTAAGAAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087400583 11:97660808-97660830 TTAAGCAAGCAGAACAAAGATGG - Intergenic
1088384876 11:109242505-109242527 TTTAAGAGGCAGGATTAATAAGG + Intergenic
1088703275 11:112434143-112434165 TGACAGAAGCAGACTTCAGAAGG - Intergenic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088899741 11:114106337-114106359 TTTAAGAAGCATCATTATGATGG + Intronic
1088996489 11:115003759-115003781 TTGAAAAAGCAGAATAAAGCTGG + Intergenic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1089857352 11:121557855-121557877 TGAAGGAAACATAATTAAGAGGG + Intronic
1089898655 11:121958444-121958466 TTATAAAAGCATAATTAACATGG + Intergenic
1090310691 11:125734844-125734866 TAAAAGAAGCAGAAAAAAGGAGG + Intergenic
1090487529 11:127127358-127127380 TAAAAGACACAGATTTAAGATGG + Intergenic
1090568797 11:128025065-128025087 ATAAAGAAGAAGTTTTAAGAGGG + Intergenic
1092234223 12:6796028-6796050 TTTTAGAAACAGAATTAATATGG + Intronic
1093384515 12:18535562-18535584 TTCAATAAGGAGAATTATGATGG - Intronic
1093390979 12:18620798-18620820 TTAAATAACCAGGATTAAGAGGG - Intronic
1093533193 12:20191620-20191642 TTAAAGCAGTATAATTATGAGGG - Intergenic
1093800639 12:23367665-23367687 TAAGAGAAGCAGAAATCAGAGGG + Intergenic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1095866391 12:46977369-46977391 TTAATGAAGAAAAATTAACAAGG - Intergenic
1096282919 12:50272219-50272241 TTCAAGCAGGAGAATTAAAATGG + Intronic
1096295093 12:50377058-50377080 TTAAAGATGCACAATTTAAAGGG + Intronic
1097006701 12:55924584-55924606 CAAAAGAAGGAGAATTAAAAGGG + Intronic
1097372143 12:58797437-58797459 TCCAAGAAGCAAAAATAAGAAGG - Intronic
1097484543 12:60179115-60179137 TCAAACTAGCAGAATAAAGAAGG - Intergenic
1097861212 12:64520454-64520476 TTAAAGAATCAGAAATTAGCCGG - Intergenic
1097894589 12:64811736-64811758 TCAAAGAAGCAGCAATAACAAGG - Intronic
1098497792 12:71156487-71156509 TTAAAAAAGTAAAATAAAGAAGG - Intronic
1098603086 12:72356703-72356725 TTAAAGAGGTAAAATTAAAAGGG + Intronic
1099071235 12:78048194-78048216 TTACAGAAGTAGACTTTAGAAGG - Intronic
1099158852 12:79214267-79214289 TTAAAAAATAAGAATTAACAGGG + Intronic
1099416208 12:82389765-82389787 TTAAAGAATCAAAATTTAGTAGG - Intronic
1100294334 12:93246802-93246824 TTTAATAAGAAGATTTAAGATGG - Intergenic
1100899125 12:99218170-99218192 TTCAAAAAGCAGAAGTTAGAAGG - Intronic
1101171087 12:102094526-102094548 TTTAAGATCCATAATTAAGATGG - Intronic
1101295152 12:103415150-103415172 TTAAACCATAAGAATTAAGAAGG + Intronic
1102791846 12:115653110-115653132 TTACAGAAGCAGAAATAGAAGGG - Intergenic
1104713155 12:130999054-130999076 TTTAAGAAGTAGAATAAAAAAGG - Intronic
1105365647 13:19761921-19761943 CTTCAGAAACAGAATTAAGAGGG + Intronic
1105671303 13:22619561-22619583 TTACAAAAGCAGAAAAAAGATGG - Intergenic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1106164911 13:27235589-27235611 TTAAAAAACCAGAAATAATATGG + Intergenic
1106487434 13:30184836-30184858 TTAAAGAGGCAGAATGAAGTAGG - Intergenic
1106773729 13:32987794-32987816 TTCATGTAGCAGCATTAAGAGGG - Intergenic
1107025958 13:35801774-35801796 GTAAAGAAACAAAATTAAGAAGG - Intronic
1108070369 13:46622854-46622876 TTAAAGAAGCTGAAGCAAAAAGG - Intronic
1108543091 13:51462658-51462680 TTAAAGAGGAAGAATAAAGCAGG + Intergenic
1108756884 13:53513791-53513813 GTAAAGAAGAAGAATTCAGTTGG - Intergenic
1109191716 13:59332280-59332302 TTATAGAAGCAGAATAGAAATGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110277855 13:73660087-73660109 TTGAAGAAGCAGTATTAAGTGGG - Intergenic
1110364773 13:74669555-74669577 CCAAAAAAGGAGAATTAAGAAGG - Intergenic
1110570941 13:77002703-77002725 TTAAAGAGGCAGTATTAATTTGG - Intronic
1110956251 13:81555580-81555602 TACTAGAAGCAGAATTAAAAGGG + Intergenic
1111371746 13:87328377-87328399 TTAAATAGGCAGAATTCAAAAGG + Intergenic
1113003598 13:105672932-105672954 TTAAAGAAACAGAGTGAACAAGG - Intergenic
1113048928 13:106187021-106187043 TGAAGGAAACAGAATTAAGTGGG + Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1113394416 13:109933326-109933348 TTAAAGAAAGAAAATTAAAAAGG + Intergenic
1113852671 13:113426684-113426706 TGAAAGACGCAAAAGTAAGAGGG + Intronic
1114036990 14:18638601-18638623 TTAATAAATCTGAATTAAGAAGG + Intergenic
1114121649 14:19676443-19676465 TTAATAAATCTGAATTAAGAAGG - Intergenic
1114132779 14:19812042-19812064 TTAAAGAACTAGAATTTACAAGG + Intronic
1114198059 14:20496344-20496366 TTTACGAAGCAAACTTAAGAAGG - Intergenic
1114791658 14:25666440-25666462 TTGAGGAAGAAGTATTAAGAGGG - Intergenic
1115180254 14:30617140-30617162 TATAAAAAGCAGAATTAAGCTGG + Exonic
1115280912 14:31662154-31662176 TTAAAGAAACACATTTAACATGG + Intronic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1115440523 14:33429742-33429764 TTTAAGAAACAGAACTAAAAAGG + Intronic
1115661228 14:35496190-35496212 TTAAAGAGGAAGTATAAAGAGGG + Intergenic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1116262306 14:42646084-42646106 TGACAGAAGTAGAATTCAGAAGG + Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117232370 14:53733915-53733937 TCAAAGAAGCAGAGTTAGAATGG + Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1118475369 14:66111420-66111442 TGAAAGAAGCAGAGCTGAGAGGG - Intergenic
1118585708 14:67350746-67350768 TTAAAGGAACATAATTATGATGG - Intronic
1119449981 14:74701224-74701246 TAAATGAAGGAGAATTAAGGAGG + Intronic
1119497387 14:75091809-75091831 TTAAAGAAGCAGAGTAAGCATGG - Intronic
1119504263 14:75158301-75158323 TGAAAGAAGCAGCATAAAAAAGG + Intronic
1120259355 14:82162307-82162329 TTAAACAAACAGAATTCAGTTGG - Intergenic
1121521897 14:94591725-94591747 TTAAACAATCAAAACTAAGAAGG + Intronic
1122681093 14:103463759-103463781 TTAAGGAAACACAAATAAGATGG + Intronic
1123575868 15:21667909-21667931 TTAAAGAACTAGAATTTACAAGG + Intergenic
1123612488 15:22110380-22110402 TTAAAGAACTAGAATTTACAAGG + Intergenic
1124683676 15:31759468-31759490 TTAAAGAAGCAGGACTCAGAAGG - Intronic
1124960640 15:34391125-34391147 TTAAAGAATCAGAAATAAATAGG + Intronic
1124977269 15:34537346-34537368 TTAAAGAATCAGAAATAAATAGG + Intronic
1125139260 15:36385170-36385192 TTAAAAAATCAGCATTAATAGGG - Intergenic
1126012567 15:44317124-44317146 TTTCAGAAGCAGATTTAAAATGG + Intronic
1126418505 15:48444978-48445000 TTAAAGAAAAATATTTAAGAAGG + Intronic
1127377991 15:58402558-58402580 TTAAAGACGCAGAATGAAGCTGG - Intronic
1127452440 15:59130516-59130538 TGACAGAAGCAGGTTTAAGAAGG - Intergenic
1128053625 15:64683976-64683998 TTTAAGAAGAAAAATTAAAAAGG - Exonic
1128614384 15:69098047-69098069 TTTAAAAAACAGAACTAAGAGGG + Intergenic
1129106993 15:73317530-73317552 TTAAAGCAGCAAAATCAACAAGG + Intergenic
1129933185 15:79429069-79429091 TTAAAGCAGCTGAGATAAGAAGG + Intergenic
1129962042 15:79696081-79696103 TTACAGAAACAAAATGAAGAAGG - Intergenic
1130367853 15:83256814-83256836 TTACAGAACAAGAATTAACAAGG + Exonic
1131110165 15:89759952-89759974 ATAAAGAAGAAGAAGAAAGATGG + Intergenic
1131649681 15:94385133-94385155 TCAAAGAAACAAAATAAAGAAGG - Intronic
1132260070 15:100416306-100416328 TTAAAGAGCCAGAAATAAGGGGG + Intronic
1132304147 15:100797931-100797953 TTAAAGCAACAGTATTAAAAGGG + Intergenic
1132445561 15:101914678-101914700 TTAAATAAGCATACTTAAAATGG - Intergenic
1202984736 15_KI270727v1_random:402154-402176 TTAAAGAACTAGAATTTACAAGG + Intergenic
1133496939 16:6327631-6327653 TTCAAGAAACAGAATAGAGAGGG + Intronic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134454473 16:14384357-14384379 ATAAAAAAGAAAAATTAAGAAGG + Intergenic
1135604208 16:23809131-23809153 GTAAAAAAGCAGACCTAAGAGGG - Intergenic
1135674723 16:24405616-24405638 TTAAAGAAGCCTCTTTAAGAAGG - Intergenic
1137306698 16:47207645-47207667 TAACAGATGCAGAGTTAAGAAGG + Intronic
1137453721 16:48601871-48601893 TTAAAGAAACTGAATTTAGCTGG - Intronic
1138785891 16:59845968-59845990 TGAGAGAAGCAGAATGAAAAAGG - Intergenic
1138956470 16:61976672-61976694 AGAAAGAAACAGTATTAAGAAGG + Intronic
1139625364 16:68184323-68184345 ATAAAGAAGATGGATTAAGATGG + Intronic
1140617992 16:76690571-76690593 TCAAATAAGCAAAATTAATATGG - Intergenic
1140879260 16:79182945-79182967 TTAAGGCAGCAGGACTAAGAAGG + Intronic
1141229182 16:82148726-82148748 TTAAAGCCCCAGGATTAAGATGG - Exonic
1141816305 16:86411826-86411848 TTACACAAACTGAATTAAGAAGG - Intergenic
1141871804 16:86791678-86791700 TAAAAGATGCATAATTAGGATGG + Intergenic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1147876912 17:43628244-43628266 AAAAAGAAGAAGAAGTAAGAGGG + Intergenic
1149245020 17:54695747-54695769 TGAAAGACGCAATATTAAGATGG + Intergenic
1149807482 17:59632448-59632470 TGAAAGAACCAAAATTAAAAGGG + Intronic
1149960507 17:61104665-61104687 TTAATGAAGCAGAATTGATGGGG - Intronic
1151520517 17:74625904-74625926 TTATAAAAGCAGAACCAAGAAGG - Intergenic
1152164619 17:78694481-78694503 TTAAATAAGGAGGATAAAGAAGG + Intronic
1152958917 18:65449-65471 TCAAATAAACAGAATAAAGAAGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153604098 18:6814104-6814126 TGAAAGAAGAAGAATAAGGAAGG + Intronic
1153840030 18:8998901-8998923 TTAAAGAGGCAGAATTCACTGGG - Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154327986 18:13405949-13405971 TTAAAGAAACGGACTTAGGAAGG - Intronic
1154472388 18:14717131-14717153 CTAAAGAAGAACAGTTAAGATGG - Intergenic
1155697675 18:28702052-28702074 GGAAAAAAGCAGAATAAAGAGGG + Intergenic
1156090281 18:33459930-33459952 TTAAGGAAGTAGAGTTATGAGGG + Intergenic
1156334534 18:36157251-36157273 TGAAAGAAGGAAAATTAAGTAGG + Intronic
1156510854 18:37635263-37635285 TGCAAGGAGCATAATTAAGATGG - Intergenic
1156513862 18:37663365-37663387 TTGAAGAAGTAGAATTTAGGTGG - Intergenic
1157769834 18:50336123-50336145 TAAAAGCATCAGTATTAAGAGGG + Intergenic
1158615142 18:58980258-58980280 CAAAAGAATCAGAATTTAGAAGG + Intronic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1158742151 18:60155253-60155275 TTAAAGAAATAGAATTGGGATGG - Intergenic
1158934994 18:62356401-62356423 TTTTAGAATCAGAATTCAGAGGG - Intronic
1160639751 19:119027-119049 TTAAATAAGCATACTTAAAATGG + Intergenic
1161388383 19:4008572-4008594 TAAAAAAAGGAGAATAAAGAAGG - Intronic
1162188716 19:8927760-8927782 GTAAAGAAGGACAATTATGATGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164856017 19:31522976-31522998 TTATCGAAGCATACTTAAGAAGG - Intergenic
1164896940 19:31885189-31885211 TCCAAGAAGGAGAATTTAGAAGG + Intergenic
1165046839 19:33111535-33111557 TTAAAAAAGCACAATTTTGAAGG + Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1166941274 19:46367612-46367634 TTTGAGAAGCAGATTTATGAGGG + Intronic
1167849108 19:52188650-52188672 TTCAAGTAGCAGAATAAAGGAGG + Intergenic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
1168633635 19:57976696-57976718 TTGAAGGAGCAGGATTCAGAAGG - Intergenic
925631394 2:5897172-5897194 TCAGAGAAACAGAATTAATAGGG - Intergenic
926665865 2:15522293-15522315 CTAAAGAAGAAGAATCAATAAGG + Intronic
926984603 2:18609027-18609049 TGAAAGAAACAGAATTTAGAAGG - Intergenic
927121894 2:19972470-19972492 ATAAAGAACAAGAATTAAGAAGG + Intronic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927587951 2:24326366-24326388 TGGAAGAAGCAGAATAAAGAAGG + Intronic
928047980 2:27957497-27957519 TAAAAGAAGCAAAACTTAGAGGG - Intronic
928082022 2:28320135-28320157 TGATAGATGCAGAATTAAAAGGG - Intronic
929396070 2:41523751-41523773 TTCAAGAGGCAGCATAAAGAGGG + Intergenic
930315347 2:49790654-49790676 ATAAATAAATAGAATTAAGATGG - Intergenic
930617014 2:53604068-53604090 TAAAAAAAGTAGAATTAAAAAGG - Intronic
931305867 2:61027648-61027670 TTACAGAACCAGAATTGAGTAGG + Intronic
931477378 2:62603020-62603042 TAAAAGAAGAAGAAGAAAGAAGG - Intergenic
932623244 2:73279115-73279137 TTAAGGAAGGAGAGTCAAGAAGG + Intronic
932962072 2:76424550-76424572 TTAAAGGGGCAGAAATATGAGGG + Intergenic
933197405 2:79407810-79407832 TTAAGGTAGCAGGATTGAGATGG - Intronic
933243367 2:79947883-79947905 TTAAAGAGGCAGATTTGATAAGG + Intronic
933263911 2:80160241-80160263 TTAAAAAAGAAGATTAAAGAGGG - Intronic
934098855 2:88632603-88632625 TGGAAGAAACACAATTAAGATGG + Intergenic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934535331 2:95128662-95128684 ATAAGGAAGAAGAAGTAAGAAGG + Intronic
934863092 2:97780674-97780696 TTAAAAAAACAGAATTCAGAGGG + Intronic
935370222 2:102337834-102337856 TGAAAGAAACTAAATTAAGAAGG - Intronic
935783580 2:106529550-106529572 TTAAAGAAGTAGAATTTCCAGGG - Intergenic
936770904 2:115912234-115912256 TTAAAGCAGGAGGAATAAGAAGG + Intergenic
937519570 2:122695647-122695669 TTTAAGAAGCAAAGTGAAGAAGG - Intergenic
937669623 2:124524468-124524490 TTTAAGAGGGAAAATTAAGAAGG + Intronic
937745714 2:125411237-125411259 TGAAAAAATCAGAAATAAGAGGG + Intergenic
937796344 2:126026661-126026683 TTACAAAATCAGAATTAAAAGGG - Intergenic
939156066 2:138525500-138525522 TTAAAAAAGCACTATTAAGTAGG - Intronic
939605131 2:144245609-144245631 TTAACCAAATAGAATTAAGATGG + Intronic
940069528 2:149670065-149670087 GTAAAGAAGCAGAGTAAAAATGG + Intergenic
941376954 2:164743276-164743298 TTAAAGAAGCAGCTTAAAGTGGG + Intronic
942179268 2:173364602-173364624 TTACAAAAGCAAAATTAAGATGG + Intronic
942718459 2:178921929-178921951 GTAAAGATGCAGAATAAAGCAGG + Intronic
943063820 2:183066460-183066482 TTAAAGAATCAGGAATAATATGG - Intergenic
943260002 2:185647368-185647390 TCAGAGAAGCAGAAATAAAATGG + Intergenic
943785757 2:191876768-191876790 TTGAAGAAGCAGCATTGAGGAGG - Intergenic
944031234 2:195237199-195237221 ATAGAGAAGCACAAATAAGAGGG - Intergenic
944209253 2:197189309-197189331 GTCAAGAAGCAGAATTGAGAGGG - Intronic
944533302 2:200685390-200685412 TAAATGAAGAAGAAATAAGAAGG - Intergenic
947149466 2:227100093-227100115 TTAAAGGAACACAATTTAGAGGG - Intronic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
1169340584 20:4793440-4793462 TTAAGGAAGGACAATTAAAATGG + Intronic
1169419253 20:5446167-5446189 CTCAAGAAGAAGAATTGAGAGGG + Intergenic
1169432628 20:5552355-5552377 TTAAAGAGGAAGAATTGAGTTGG - Intronic
1169639692 20:7736880-7736902 TTAAAAAACCAGAAATAAAAGGG - Intergenic
1169851916 20:10061605-10061627 TGAGAGAAGCAGAATAAAGCAGG + Intergenic
1170062938 20:12278161-12278183 TTAAAGGTCAAGAATTAAGAAGG + Intergenic
1170361973 20:15556098-15556120 TTAGAGAAGGAAAATTAAAATGG + Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172249855 20:33471429-33471451 TTAAGTAAGCAGAATGTAGAAGG + Intergenic
1173244886 20:41329894-41329916 TTAAAGAAGGAGTAGGAAGAGGG - Intergenic
1173457922 20:43218312-43218334 TCAAAGAAGCTGGATAAAGATGG - Intergenic
1173779058 20:45738230-45738252 TCATAGAAGCAGAATTAGAATGG + Intergenic
1176802103 21:13440768-13440790 GTAAAGAAGAACAGTTAAGATGG + Intergenic
1176912938 21:14589516-14589538 TTAAATATACATAATTAAGAAGG + Intergenic
1177117790 21:17106100-17106122 TGATAGAAGTAGAATTCAGAGGG + Intergenic
1177639181 21:23824495-23824517 TTAAAGAAGTTTAATTTAGATGG + Intergenic
1177795530 21:25774882-25774904 TTAAAGAAGCAAAACTAGGCTGG + Intergenic
1177830875 21:26137358-26137380 ATAAAAAAGCAAAATTTAGATGG - Intronic
1177948677 21:27505917-27505939 TTAAAACAGCACAATCAAGATGG - Intergenic
1178451263 21:32703467-32703489 TTAACGAGGCAGTATTTAGAAGG - Intronic
1178688711 21:34732806-34732828 TTTAAGAACCAGAATAGAGATGG + Intergenic
1179401383 21:41087259-41087281 TCAATGAAGCACAAATAAGAGGG - Intergenic
1180461114 22:15565649-15565671 TTAATAAATCTGAATTAAGAAGG + Intergenic
1180735115 22:18010740-18010762 AGAAAGAAGGAGAATTGAGAAGG + Intronic
1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG + Intronic
1182692426 22:32173397-32173419 TTTCACAAGCAAAATTAAGAGGG - Intergenic
1183805934 22:40211067-40211089 TTCAGGAAGCAGTATTAAAAGGG - Intronic
1183993545 22:41615441-41615463 TTAAAAAAGCAGAATCACGCAGG + Intronic
949639291 3:6016829-6016851 TTAAAGGATCAAAATGAAGATGG - Intergenic
950358690 3:12434606-12434628 TTTAACAATCAGAACTAAGAAGG + Intergenic
950623184 3:14224366-14224388 TGAAAGAAGCAGTATCAGGAGGG + Intergenic
950985745 3:17363698-17363720 TTAAAGAAACAGAAATTAGGTGG - Intronic
951598464 3:24344078-24344100 TTAACTAAGCTGAATTAGGAGGG + Intronic
952310842 3:32188250-32188272 TTAAAAAGGAAGAATTAAGTTGG - Intergenic
952667561 3:35925077-35925099 ATAAAGAATGAGAATTAAGAAGG - Intergenic
953394614 3:42557832-42557854 TAAAAGCAGCAGAAGTTAGAGGG + Intronic
953890388 3:46747947-46747969 TTAATGAGGCTGAATTAAAAGGG + Intronic
953939702 3:47082378-47082400 GTAAAGAAGCTCAGTTAAGAAGG - Intronic
954255934 3:49406190-49406212 TTAAGGAAGTAAATTTAAGATGG - Intronic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
956191667 3:66614002-66614024 TTAGAGCAGCCAAATTAAGATGG + Intergenic
956374457 3:68599540-68599562 TTAAAGGATTAGAATTGAGATGG + Intergenic
956525939 3:70160795-70160817 TGGAAGAGTCAGAATTAAGATGG - Intergenic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957504352 3:81100492-81100514 TTTAAGAAGCAGAGATGAGATGG - Intergenic
958076833 3:88691094-88691116 TGACAGAAGCAGACTTCAGAAGG + Intergenic
958563238 3:95775816-95775838 GTACAGAAGCAGAACTAAGGCGG + Intergenic
958582801 3:96048113-96048135 TAAATGATGCAGAATGAAGAGGG - Intergenic
958915131 3:100041289-100041311 TTAGAAAAGCAAAATTATGATGG + Intronic
958962608 3:100524205-100524227 TGAAAGAAGCAGGATAGAGAAGG - Intronic
959185422 3:103040677-103040699 TCAAAGATTCACAATTAAGAAGG - Intergenic
959686218 3:109149909-109149931 TTAAAGCAGGAGGATGAAGATGG + Intergenic
961312076 3:126008882-126008904 TGAAAGAAACAGAACCAAGAAGG + Intronic
961902395 3:130225657-130225679 ATAAAGAAACAGAGATAAGAAGG + Intergenic
962058432 3:131899512-131899534 TTGAAAAAGCAGAAATAACATGG + Intronic
962204949 3:133426632-133426654 TGAAAGATGAAGAATCAAGATGG - Intronic
962314341 3:134349856-134349878 TTAAAGAGGCGTTATTAAGAAGG - Intergenic
963649882 3:147965710-147965732 TAAAGGAAGCAGAATAAGGATGG - Intergenic
963995718 3:151706068-151706090 TTAAAGGAGCAGATTTATTATGG - Intergenic
964048226 3:152357697-152357719 TTAAAGAAGCAAGAGTAAGGTGG - Intronic
964322570 3:155513532-155513554 GACAAGAAGCAGAATCAAGATGG + Intronic
964919019 3:161872974-161872996 GTACAGAAGCAGAAATAAAAAGG - Intergenic
966308972 3:178572624-178572646 TTAAAGATGCAGAAGTAAAGTGG - Intronic
966462866 3:180197035-180197057 AGAAAGAAACAAAATTAAGATGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966963290 3:184963112-184963134 TTAAAGAAAAAGAATAAGGAGGG - Intronic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
967687248 3:192432075-192432097 TTGAAGAATGGGAATTAAGAGGG - Intronic
967901490 3:194458081-194458103 TAAAATAAGCATAATTAAGGCGG - Intronic
969295335 4:6267202-6267224 GTAAGGAAGCAAAATTAAGGGGG - Intergenic
971083500 4:23243282-23243304 TTAATGAAGCTGAAATGAGAAGG + Intergenic
971353835 4:25876682-25876704 TTAAAGCAGGAGGATTAAGCAGG - Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972988382 4:44793132-44793154 TTAAGGATGCAGCATTAAAAGGG + Intergenic
973122363 4:46537922-46537944 GTAAACAAGCATGATTAAGAAGG + Intergenic
973543654 4:51959098-51959120 TTGAAGAAGCAAAATTAACTTGG + Intergenic
973876501 4:55225145-55225167 TTTAAAAAGCAGACATAAGAAGG - Intergenic
974192665 4:58527246-58527268 TAAAAGAAACAGAATCAATAGGG - Intergenic
974496935 4:62642330-62642352 TTAAAAAAGCAAAATGAAAAAGG - Intergenic
975519421 4:75283558-75283580 TCAAAGAAGCAAAGTCAAGATGG - Intergenic
976063824 4:81160922-81160944 TTAAAGTCACAGAACTAAGATGG + Intronic
976536800 4:86227085-86227107 TTGATGAATCAGAAATAAGAAGG + Intronic
976552472 4:86412883-86412905 TTACAGAAGTAGACTTCAGAAGG - Intronic
976867936 4:89753352-89753374 TTAAAGCAGCAGATTTCAAAAGG + Intronic
977049421 4:92108402-92108424 TTAAATAATCCTAATTAAGAAGG - Intergenic
977417732 4:96755987-96756009 TTAAAGAAGGCTAATTAAAATGG + Intergenic
977506806 4:97912329-97912351 TGAAAGAAGTAGACTTCAGAAGG + Intronic
978024286 4:103852386-103852408 TTAAAAAATTAGAACTAAGAAGG + Intergenic
978128989 4:105171043-105171065 TTAAAAAAAAAGAATGAAGAAGG - Intronic
978608554 4:110510082-110510104 TTAAATAATCAGAATAAAGCAGG + Intronic
978815057 4:112894759-112894781 TTATAGGAGCAGAAACAAGAGGG + Intronic
979585232 4:122407729-122407751 TCTAAGAAGCAAAATTAAAAAGG - Intronic
979707248 4:123735277-123735299 TTAAAGGAGAAGATTTAAAAGGG - Intergenic
980593902 4:134927989-134928011 TGATAGAAGCAGACTTCAGAAGG - Intergenic
980680493 4:136153881-136153903 TCAAAGAAGCAGCTTTAGGAAGG - Intergenic
981060970 4:140425408-140425430 TCAGAGAAGCAGAATCAATAGGG + Intronic
981384211 4:144108695-144108717 TTAATGAATCATAGTTAAGAAGG + Intergenic
981432247 4:144674777-144674799 TTTAAGAAGCATGATTAAGTGGG - Intronic
981584405 4:146285673-146285695 TTAAGGAAACAGAATTAAAGAGG + Intronic
981833911 4:149032459-149032481 TTACAGAAGAATAATTTAGAAGG - Intergenic
981968379 4:150634510-150634532 TTAAGGAAGCAGTATGAATAGGG + Intronic
982251454 4:153411347-153411369 TTAAAGAAACAACCTTAAGACGG - Intronic
982607301 4:157530779-157530801 TTCATGAAATAGAATTAAGAAGG + Intergenic
982950379 4:161687336-161687358 TTAAAGAAATAGTATAAAGATGG - Intronic
983460499 4:168020618-168020640 TTAAAGAAGCATAATAAAATGGG + Intergenic
983589681 4:169394391-169394413 TTAAAAAATCAGATTTAAGATGG - Exonic
983709801 4:170699805-170699827 TGACAGAAGAAAAATTAAGATGG - Intergenic
983849264 4:172560175-172560197 TAAAAGAAGCAGAAGTGAGGTGG + Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984076672 4:175190112-175190134 AAAAAGAAGCAAAACTAAGAGGG - Intergenic
984351739 4:178603183-178603205 ATAAGGAATCAGAATGAAGATGG - Intergenic
984454434 4:179946337-179946359 TTATAGCAGCAGAATACAGACGG - Intergenic
984470353 4:180163088-180163110 TTAAGGAAGAAGAATTATGTAGG - Intergenic
984720151 4:182963986-182964008 TTAAAGAAGCTGAGAGAAGAAGG - Intergenic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985501296 5:248584-248606 TTATAGAAGCAGATTTATCATGG - Intronic
985611484 5:892121-892143 TTCAAGAAGATGGATTAAGAGGG + Intronic
986340261 5:6783073-6783095 TTAAAGGAAAAGAATGAAGAGGG - Intergenic
986644784 5:9906267-9906289 ATAAAGAAACAGAATTATGTTGG - Intergenic
986852104 5:11825635-11825657 TAAAAGCAACAGAATTATGATGG - Intronic
986889419 5:12283468-12283490 ATAAATATGCAGAAATAAGATGG - Intergenic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
987888982 5:23851371-23851393 TAAAAGAGGCAGAATCAACATGG - Intergenic
988122098 5:26977922-26977944 TTAAGGAAGCTGTACTAAGAAGG + Intronic
988269005 5:28990598-28990620 TAAAATAAGTAGAATAAAGAAGG - Intergenic
988281015 5:29147559-29147581 CTAAATGAGCAGAATTATGAGGG + Intergenic
988329730 5:29819923-29819945 TTAAAAAAGAAGAACTAATATGG - Intergenic
988717066 5:33838693-33838715 AGAAAGAAGCAGAAGTAACAGGG + Intronic
989296757 5:39837044-39837066 TTAATGAAGCAGTGTAAAGAAGG - Intergenic
989561395 5:42856213-42856235 TTAAAAAAGTAGATTGAAGAGGG + Intronic
989792557 5:45423271-45423293 CTCAAGAAGCAGAATAGAGATGG + Intronic
990199075 5:53351013-53351035 TTAAACATACAGAACTAAGAGGG + Intergenic
990565958 5:57029410-57029432 TGAAAGCAGCAGAATTAAAATGG + Intergenic
991329556 5:65479100-65479122 ATAAATAACCAGAGTTAAGATGG - Intronic
991350821 5:65719215-65719237 TTATAGAAGCAGTTTCAAGATGG + Intronic
991414241 5:66376170-66376192 TTAAACAAATAGATTTAAGAAGG + Intergenic
991472619 5:66985169-66985191 TCAAAGAAGCGGAATGAAGGAGG + Intronic
992022525 5:72638477-72638499 ATAAAGAATCAGAATTTACATGG + Intergenic
992552183 5:77869361-77869383 ATAAAGAAGGAGAATCAATAGGG - Intergenic
992590212 5:78286916-78286938 TTAAAGTAGAATAATCAAGAAGG - Intronic
992804865 5:80326991-80327013 TTAAAAAAGGAAAATCAAGAAGG - Intergenic
993243407 5:85420387-85420409 TTGAAGAAGCTTAATTAGGATGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
993964104 5:94339252-94339274 TATAAGAGGCACAATTAAGATGG - Intronic
994346677 5:98696100-98696122 TGACAGAAGTAGAATTCAGAAGG - Intergenic
994924778 5:106100748-106100770 TGAAGGAAGCAGAAGTAAGTGGG + Intergenic
995233440 5:109798043-109798065 TTAAAAATGAAGAATTAAAAAGG + Intronic
995432155 5:112092127-112092149 TTAAAGATGAATCATTAAGAAGG - Intergenic
996413909 5:123188810-123188832 ATAGAGAAGCAAAATTAAAAGGG - Exonic
996488369 5:124063548-124063570 CTAAAGAAGCAGAATCAATAGGG + Intergenic
996994540 5:129679313-129679335 TTAAAGAAGGATCATTAAGCAGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999020559 5:148161121-148161143 TAAAACAAGCAAAATAAAGATGG + Intergenic
1000684173 5:164226345-164226367 TTAAAGATGCAGAATGCAGATGG - Intergenic
1001172605 5:169434798-169434820 TTAAATCAGAAGAATTTAGAAGG + Intergenic
1002747102 6:67434-67456 TTAAATAAGCATACTTAAAATGG + Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003440253 6:6134245-6134267 TTATTGAAGCATAACTAAGATGG + Intergenic
1003803628 6:9700644-9700666 TAAAAGATGCAGAATAAATATGG - Intronic
1004443236 6:15673502-15673524 TTAAAGAAGTAGAAAGAAGTGGG + Intergenic
1005087445 6:22021648-22021670 AAAAAGAAGAAGAATTCAGATGG - Intergenic
1005269030 6:24143291-24143313 TTAAAGAAGCATACTTTAGCCGG - Intronic
1005369516 6:25116549-25116571 TTGAAAAAGAAAAATTAAGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006766717 6:36512958-36512980 TTAAAGAAGAAAAATTACGCTGG - Intronic
1007251659 6:40499398-40499420 TTAAAGAATCAGAAATAACTTGG + Intronic
1008721981 6:54365550-54365572 TTTAAGAAGCACATTTAAGAAGG - Intronic
1008854102 6:56060870-56060892 TGAAAGAAGCAGAATACATACGG + Exonic
1009041346 6:58182526-58182548 TCAAAGTAGCAGAATTGAGAGGG - Intergenic
1009217199 6:60936841-60936863 TCAAAGTAGCAGAATTGAGAGGG - Intergenic
1009339570 6:62537085-62537107 ATAAAGAAGAGGAAGTAAGAAGG - Intergenic
1010561684 6:77358870-77358892 ATAAAGAAGGAGACTAAAGAAGG + Intergenic
1011253822 6:85401346-85401368 TTTAAGAAGCAGAAGAGAGAGGG + Intergenic
1011435955 6:87336960-87336982 TCAGAGAAGCACAATTATGAAGG + Intronic
1012561914 6:100592024-100592046 TTAAATAAACAGACTTTAGAAGG - Intronic
1012574511 6:100776011-100776033 TTAAAGAAGAAGAATAATGTGGG + Intronic
1013821077 6:114154115-114154137 TTAACGAAGGAGAGGTAAGAAGG + Intronic
1013856367 6:114578478-114578500 TTCAAGGAGCAGAGTAAAGAAGG + Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014685538 6:124495224-124495246 TCAAAGCTGCATAATTAAGATGG - Intronic
1015276666 6:131389372-131389394 TAAAAGAATCAGATTTAAGAGGG + Intergenic
1015678311 6:135775927-135775949 CTAAGGAGGCAGAATTCAGAGGG - Intergenic
1016519906 6:144935497-144935519 TTAAAAAAGGAGAATGAACAGGG - Intergenic
1016850233 6:148611692-148611714 TGAAAGAAGCAGAACTGAGATGG + Intergenic
1017217786 6:151930279-151930301 TTAAAGAAGTATAGTTAAGCCGG - Intronic
1017368682 6:153677855-153677877 TTAAAGAAGGAAAAATAAGTAGG + Intergenic
1017676428 6:156819180-156819202 TTTAAGAAGGAGAAATAATATGG - Intronic
1018249616 6:161855878-161855900 TTAAAAAAGCAGAATCAAGCAGG + Intronic
1020219498 7:6224176-6224198 TTTAAGAAGCAGAATTAACCAGG - Intronic
1020534493 7:9378538-9378560 TTAAAAATCCAGAATTAAGTAGG - Intergenic
1020667373 7:11064636-11064658 CTAAAAAAGGACAATTAAGAAGG - Intronic
1020729423 7:11862981-11863003 CTAAAGAAGAAAAATTAATATGG - Intergenic
1021171899 7:17407353-17407375 TTAAAGAAAAAGAATAAAGTTGG + Intergenic
1021632077 7:22657284-22657306 CTAAAGAAGCAACATTAAAATGG + Intergenic
1021674250 7:23064503-23064525 CCAAGGAAGCAGAATTCAGAGGG - Intergenic
1022495754 7:30852112-30852134 TTAAATAAGGACAAATAAGAAGG - Intronic
1022642123 7:32197085-32197107 TGAAGGAAGCATACTTAAGATGG - Intronic
1023072032 7:36444661-36444683 AGAAATAAGCAGAATTAAAAAGG + Intronic
1023634232 7:42193752-42193774 TTAAAGAAATAAAAATAAGATGG - Intronic
1024064841 7:45723991-45724013 TCAAAGAAACAGAACCAAGAGGG + Intergenic
1024104849 7:46072514-46072536 TTAAAGAAAAAGAACTAACATGG - Intergenic
1024366161 7:48522541-48522563 TTAAATAGGAAGAATTCAGATGG - Intronic
1024597377 7:50950567-50950589 CAATAGAAGCAGTATTAAGAGGG + Intergenic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1024846276 7:53646453-53646475 TTAAAGAAAAAGAAGAAAGATGG - Intergenic
1024904604 7:54362317-54362339 TTAAAGAGGTAAAATTAAAATGG - Intergenic
1027588866 7:80092378-80092400 CTAAAGAACCAAAATTAAGACGG - Intergenic
1027888183 7:83936332-83936354 TGAAAGAAGTATAATAAAGAAGG + Intergenic
1028305223 7:89254953-89254975 TTAAAGAAGAAAAATAAAGAGGG + Intronic
1028491469 7:91416936-91416958 TTAAAGACCCAGAATAAAGTAGG - Intergenic
1030580334 7:111347257-111347279 TTAAAGAAGCTTGGTTAAGAAGG + Intronic
1031192291 7:118568572-118568594 TTAAACAACTAGAATTAATAAGG + Intergenic
1031682557 7:124692445-124692467 GTAATGAAGAAGAATTAAGGAGG + Intergenic
1031727018 7:125252629-125252651 TTAAATAAGCAAAACTAAAAAGG + Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033561849 7:142539395-142539417 TAAAAGATGTAGAATTAAGTTGG - Intergenic
1033941591 7:146661536-146661558 TGAAAGAAGCAGAAATAGCATGG - Intronic
1034464794 7:151220663-151220685 CCAGTGAAGCAGAATTAAGAAGG + Intronic
1034592509 7:152154130-152154152 TTAAAGGTTCAGAATCAAGAAGG - Exonic
1035147824 7:156838082-156838104 TTAAAAAAGCAAAATTAGGCTGG - Intronic
1036109195 8:5878889-5878911 TTAAGAAAGCAGCATTAAAAGGG - Intergenic
1037095904 8:14986943-14986965 TTAAAGGAGGAGAATAAAAATGG + Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037514821 8:19619937-19619959 TTAGAGAACTAGAATTTAGAAGG - Intronic
1037527167 8:19737655-19737677 TAAAAGAAGTAGAATAAATAAGG + Intronic
1037986289 8:23292660-23292682 TTTAGGAAGCAGAGTTAACAAGG - Intronic
1038138671 8:24818883-24818905 TTTAGGAAGAAGAGTTAAGATGG + Intergenic
1039688889 8:39840460-39840482 TAAAAGAACAAGAATTAATAAGG - Intergenic
1039697035 8:39923963-39923985 GTAAAAAAACAGAATTAGGAAGG - Intronic
1040044015 8:42943006-42943028 TTGAAGAAGTAGAACTAAAATGG - Intronic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1040868161 8:52071258-52071280 TTACTGAAACAGACTTAAGAAGG - Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1040938275 8:52804661-52804683 GTCAAGAAGCAGAATTAATTAGG - Intergenic
1041420059 8:57657164-57657186 TTGAAAAAGAAGAATTAAGTTGG - Intergenic
1041856517 8:62462069-62462091 TGAAAGGAGCAAAATAAAGATGG + Intronic
1041921883 8:63191464-63191486 TTAAGAAAACAGAGTTAAGAGGG - Intronic
1042112610 8:65396643-65396665 TGAAAGAAGAAGCATTAAAAAGG - Intergenic
1042720143 8:71818714-71818736 TTAAACTAGCAAAATTAAAATGG - Intergenic
1043670246 8:82875565-82875587 TTTAGGAAACAGAAGTAAGAAGG + Intergenic
1043742296 8:83829057-83829079 TTAAAGAAGCCAATTTAAAAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1044861677 8:96529938-96529960 GTAAATAAGCAGAATAAAGCTGG - Intronic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045899253 8:107256155-107256177 ATAAAGATGATGAATTAAGATGG + Intronic
1046261664 8:111776182-111776204 TTAAAGAGGAAGAAATAAGCAGG + Intergenic
1046498099 8:115040253-115040275 TTGAAAAAGAAGAAATAAGATGG - Intergenic
1046514703 8:115243130-115243152 TGAATGAAGCATAATTAAAAAGG + Intergenic
1047137633 8:122098518-122098540 TTAAATAAGAAGATTTCAGAGGG + Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1048502872 8:134994574-134994596 TCACAGCAGCAGATTTAAGAAGG + Intergenic
1048654143 8:136516471-136516493 AAAAAGAATCAGAATTAAGCAGG - Intergenic
1048724915 8:137372676-137372698 TGAAAGAAGCAGAAGTTAAAGGG - Intergenic
1049043286 8:140129142-140129164 TTAAAGAAACAGATTTAAGTAGG - Intronic
1049987457 9:965077-965099 TTAAGGAAGCTGCATTAAAATGG + Intronic
1050114472 9:2249440-2249462 TTAAAAATGCAAAATTAACAGGG - Intergenic
1050213066 9:3286774-3286796 TTACAGAAGGAGAATCAAGGAGG - Intronic
1050614344 9:7386424-7386446 TTACAGAATCAGAACAAAGAGGG + Intergenic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051129181 9:13840732-13840754 TTTAAGAAACAGAAATAAGCAGG + Intergenic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051435761 9:17029752-17029774 CTGAAGTTGCAGAATTAAGAAGG + Intergenic
1052066284 9:24024970-24024992 AGAAAGAAGCATAATTAAGACGG + Intergenic
1052276068 9:26678103-26678125 TTCAAGAAGATGGATTAAGATGG + Intergenic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1053371998 9:37569971-37569993 TTAAAGAAAAAGAATTACAATGG + Intronic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1055011642 9:71572990-71573012 TAAAAGAAGGAGAATTGAGGTGG + Intergenic
1055393496 9:75848680-75848702 TTAAAGAAGTAGAAATAGGCCGG + Intergenic
1055420340 9:76134013-76134035 TTAAAAAAGCAAAATCAAAATGG - Intronic
1055624982 9:78167374-78167396 TCTAAGAAGTAGAACTAAGAAGG - Intergenic
1056330241 9:85515199-85515221 TAAAAGAACCACAATAAAGAAGG - Intergenic
1057483737 9:95465738-95465760 TTAAACAAGCCTAATTAAGTGGG + Intronic
1058010084 9:99967524-99967546 TTAATGAACCACTATTAAGATGG + Intronic
1058478018 9:105360565-105360587 TCAAAGAACCAGACTGAAGAGGG - Intronic
1058842520 9:108923843-108923865 TGCAAGAAGCACAATAAAGATGG + Intronic
1059583681 9:115581428-115581450 TAAAAGAAGCAGAACTTAGTTGG - Intergenic
1060084988 9:120690235-120690257 TTAAAGAATGGGAATAAAGAAGG + Intronic
1060120635 9:120986299-120986321 GGAAAGAAACAGAAATAAGATGG + Intronic
1060123144 9:121015281-121015303 ATAAAGAAGAAGGATTAAAAAGG + Intronic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1060441225 9:123641272-123641294 TTAAAGAATCAGAATTTTAAAGG - Intronic
1060734365 9:126057081-126057103 AAAAAGAAGAAGAATTAAAAAGG + Intergenic
1203734786 Un_GL000216v2:126409-126431 TTAAAGAACCAGATTTTAGCAGG + Intergenic
1186644734 X:11494421-11494443 TTACAGAAGCAAGATTCAGAAGG + Intronic
1187476033 X:19611754-19611776 CTTAAGAAGCAGAATATAGATGG - Intronic
1187481522 X:19660302-19660324 ATAAAGAAGCATTATGAAGATGG - Intronic
1188312896 X:28639665-28639687 TCAAAGAAGCAGAATAAAAAAGG + Intronic
1188416193 X:29937847-29937869 CTAAAGAAACAGAATTTACAAGG - Intronic
1188792951 X:34426233-34426255 TTAAATATTCAGAATTAAGCAGG + Intergenic
1189105674 X:38232914-38232936 TCAAAGAAGCAGAATCAGTAGGG - Intronic
1189694987 X:43654695-43654717 TTAAGGAAGCAGATATATGAAGG - Intergenic
1190436153 X:50427794-50427816 AAAAAGAAGAATAATTAAGAGGG + Intronic
1191789908 X:64958810-64958832 AGAAAGATGGAGAATTAAGAAGG + Intronic
1191997973 X:67116841-67116863 GTAAAGAAAATGAATTAAGAAGG - Intergenic
1192043459 X:67646900-67646922 TTAAAGAAGCAATCTTCAGATGG + Intronic
1192885114 X:75328614-75328636 TTATAGAAGCAGACTTATTATGG - Intergenic
1192918354 X:75678873-75678895 TTAAAAAAGAAAAATGAAGAGGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193637130 X:83965104-83965126 TTAAAGAAGCAAAAATTAGTGGG + Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1194037354 X:88892736-88892758 CTAAAGAAGCCGAATTCAGTGGG - Intergenic
1194406999 X:93509022-93509044 TTAAAAAAGAAGAATCAAGTGGG + Intergenic
1194423516 X:93707400-93707422 TTAAAGGATCAGATTTAAGATGG + Intronic
1194670933 X:96731376-96731398 TTAAAGAAAATGAATTAAGTTGG - Intronic
1194745262 X:97621181-97621203 TTAATGAAGCTGAATTAATATGG - Intergenic
1194907741 X:99598875-99598897 AAAAAGACTCAGAATTAAGAAGG - Intergenic
1195559647 X:106269047-106269069 TTTAAGAGGCAGATTAAAGAAGG + Intergenic
1195562314 X:106297292-106297314 TTTAAGAGGCAGATTAAAGAAGG - Intergenic
1195564137 X:106322746-106322768 TTAAGTAAGCACAATTAAGCAGG + Intergenic
1196694572 X:118597530-118597552 TGAATGATGCAGAATCAAGAAGG + Exonic
1198683755 X:139206415-139206437 TTAACAAAACCGAATTAAGAAGG - Intronic
1199427623 X:147721388-147721410 TTAAAGAAGCAGCATTAATATGG + Intergenic
1199840572 X:151643270-151643292 TTCCAGAAGCAAAACTAAGAAGG + Intronic
1201297291 Y:12474717-12474739 TTAAGGAAACAGGATTAAGGTGG - Intergenic
1201553552 Y:15244426-15244448 TTTCAGAAGTATAATTAAGAAGG - Intergenic
1201782492 Y:17738911-17738933 TTGAAAAAGCAGGTTTAAGAAGG + Intergenic
1201819061 Y:18167077-18167099 TTGAAAAAGCAGGTTTAAGAAGG - Intergenic
1201853967 Y:18520484-18520506 TTGAAAAAGCAGATTTAAGAAGG - Intergenic
1201879354 Y:18799900-18799922 TTGAAAAAGCAGATTTAAGAAGG + Intronic
1201922301 Y:19246399-19246421 TTATAGAAGTAGACTTCAGAAGG + Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic
1202626245 Y:56862120-56862142 TTAAAGAACCAGATTTTAGCAGG - Intergenic