ID: 954998018

View in Genome Browser
Species Human (GRCh38)
Location 3:54899827-54899849
Sequence CCGTTCATCCAGGAGCTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954998018_954998023 -7 Left 954998018 3:54899827-54899849 CCATCCAGCTCCTGGATGAACGG 0: 1
1: 0
2: 1
3: 4
4: 123
Right 954998023 3:54899843-54899865 TGAACGGAAATCTCCTGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 90
954998018_954998022 -10 Left 954998018 3:54899827-54899849 CCATCCAGCTCCTGGATGAACGG 0: 1
1: 0
2: 1
3: 4
4: 123
Right 954998022 3:54899840-54899862 GGATGAACGGAAATCTCCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 98
954998018_954998024 -3 Left 954998018 3:54899827-54899849 CCATCCAGCTCCTGGATGAACGG 0: 1
1: 0
2: 1
3: 4
4: 123
Right 954998024 3:54899847-54899869 CGGAAATCTCCTGTGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954998018 Original CRISPR CCGTTCATCCAGGAGCTGGA TGG (reversed) Exonic
901511899 1:9721753-9721775 ACGTGCATCTCGGAGCTGGAAGG - Exonic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
912624471 1:111196042-111196064 CACTTCATCCAGGATCTGCAGGG + Exonic
916770040 1:167899101-167899123 CGGTTCATCCAGGAGCAGAGGGG - Intronic
918148656 1:181780034-181780056 CAGACCATCCAGGAGCTGGGAGG - Intronic
918683140 1:187380049-187380071 TGGTTCACCCAGGAGCTTGACGG - Intergenic
922819823 1:228476586-228476608 CAGTTCAAACAGGAGCTGGGAGG + Intergenic
922889084 1:229046635-229046657 CCGTACCTCCTGGAGCTGGCTGG + Intergenic
1065001381 10:21340724-21340746 CCGTTCATTGAGCAGATGGACGG + Intergenic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1069638240 10:69938427-69938449 GCATTCTTCCAAGAGCTGGAAGG + Intronic
1072617112 10:97057200-97057222 TCGTTCTTACAGGAGCTGTAGGG + Exonic
1073059119 10:100722982-100723004 GGGCTCTTCCAGGAGCTGGATGG + Intergenic
1075406201 10:122197397-122197419 CCATTCATCCCAGAGCTGGCAGG - Intronic
1075873145 10:125785825-125785847 TCCTCCATCCAGGAGCTGGAGGG + Intronic
1076695453 10:132245188-132245210 CTGTACAGCCAGGAGCAGGAGGG + Intronic
1078893555 11:15578692-15578714 AAGCTCAGCCAGGAGCTGGAGGG + Intergenic
1081596719 11:44464323-44464345 CTGGTCATCCAGGAGCTGGAAGG + Intergenic
1083249194 11:61454429-61454451 CCAATCATCCATGAGCAGGAGGG + Intronic
1083424314 11:62575272-62575294 CAGGTCACCCAGGAGCTGAAAGG - Exonic
1088017734 11:105081309-105081331 CAGTTCACCCAGGAGCTACATGG + Intronic
1089322272 11:117634462-117634484 AGCTTCATCTAGGAGCTGGACGG - Intronic
1090081681 11:123617870-123617892 AGGATCATCCAGGGGCTGGAGGG - Intronic
1092044636 12:5421954-5421976 TCTTTAATCCAGGAGGTGGAGGG + Intergenic
1094460830 12:30695613-30695635 CGGATCATCCAGGCGCTGAAGGG - Exonic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1104039908 12:125122935-125122957 CCGTGCTTCCAAGAGCTGAATGG + Intronic
1105957803 13:25300913-25300935 CCGTGCATCCTGATGCTGGAGGG - Intergenic
1106619750 13:31361933-31361955 TCATCCATCCAGGAGCAGGAAGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1107708346 13:43128808-43128830 CCGTTCAGCCTGGAGATGGTGGG - Intergenic
1111815746 13:93150350-93150372 CCCCTCATCCAGGAGAGGGAGGG + Intergenic
1112029412 13:95443530-95443552 ACGGTCATTCAGGAGCTGGGTGG + Intronic
1112710692 13:102124658-102124680 CTCCTCATCCAGGAGCAGGAGGG + Intronic
1112801219 13:103111575-103111597 CAATTCATCCAGAACCTGGAAGG - Intergenic
1117420862 14:55543631-55543653 CAGTTTACCCAGGACCTGGAAGG + Intergenic
1120100492 14:80439259-80439281 CCCTTCACCCAGGAGCTGTTGGG - Intergenic
1128252377 15:66172282-66172304 GCCTCCCTCCAGGAGCTGGAAGG + Intronic
1128657664 15:69474382-69474404 CCACTTTTCCAGGAGCTGGAGGG - Intergenic
1129333940 15:74841481-74841503 CCGTTCATGCAGGAATTGCAGGG + Exonic
1134359436 16:13517638-13517660 CCGTTCATTGAGTATCTGGATGG + Intergenic
1135737785 16:24946382-24946404 TCGTACAGCCAGGACCTGGATGG - Intronic
1136553843 16:30996749-30996771 CCTTTCTTCCCGCAGCTGGAAGG - Exonic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1137548410 16:49419695-49419717 AGCTTGATCCAGGAGCTGGATGG + Intergenic
1140034351 16:71361111-71361133 CCCTTCACCCCGGAGCAGGAGGG - Intronic
1141807683 16:86352500-86352522 CCCTGCACCCAGGAGCTGGGGGG + Intergenic
1143668134 17:8376560-8376582 CCGTTCAGCCCTGAGCTGGCGGG - Intronic
1149553395 17:57556348-57556370 CCCTTCCTCCAGGATCTGCAGGG + Intronic
1151621308 17:75246712-75246734 CAGATCAACAAGGAGCTGGAAGG - Exonic
1152369493 17:79877609-79877631 CCCTTCCTCCACGAGGTGGAGGG + Intergenic
1152994623 18:395101-395123 CTGTTGATCCAGTTGCTGGAAGG + Intronic
1153457362 18:5295674-5295696 CCGCACATCCTGGAGCTGGCTGG + Intronic
1160828028 19:1089772-1089794 CCCTTGATCCAGGGCCTGGAGGG - Intronic
1160906409 19:1453578-1453600 CAGTTCCTCCAGCAGCCGGATGG - Exonic
1160942160 19:1625447-1625469 ACGTCCAGCCAGGACCTGGAAGG + Intronic
1165834150 19:38744118-38744140 CTCCTCATCCACGAGCTGGATGG + Exonic
1166220526 19:41361420-41361442 CCCCTCATCCATCAGCTGGAGGG + Intronic
1166506138 19:43372908-43372930 TGGTTCAACAAGGAGCTGGAAGG + Intergenic
1166752454 19:45170808-45170830 CAGTTCAGCCAGGATCTGAATGG - Intronic
1166992261 19:46699605-46699627 CAGTTCACACAGGCGCTGGAGGG - Intronic
925154071 2:1637026-1637048 CCGTTCATCCTGAGGGTGGAAGG + Intronic
927937510 2:27083958-27083980 ACGGTCCTCCAGGAGCTGCAGGG - Exonic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
934705596 2:96476231-96476253 CTGTTCTTCCTGGGGCTGGAGGG - Intergenic
936715399 2:115181422-115181444 GCATTCATCCGGTAGCTGGAAGG + Intronic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
948701251 2:239761850-239761872 CCCTTCCTCCAGGACCTGCAAGG - Intergenic
1170007154 20:11681642-11681664 ACGCTCATCCATGAGATGGATGG + Intergenic
1170479580 20:16752720-16752742 GAGCTCATCCAGGAGTTGGAAGG + Intronic
1171454335 20:25258991-25259013 GTGTTCATCCAGGGACTGGAGGG + Intronic
1173880812 20:46410994-46411016 TCGTTCTTCCAGGAACTGGGGGG + Intronic
1174265464 20:49328606-49328628 CCGCTCTTCCAGCAGCGGGAAGG - Intergenic
1175866348 20:62179244-62179266 GTGTTCATCCAGGGGCCGGATGG + Exonic
1175916852 20:62430037-62430059 CTGATCAGCCAGGAGCTGGGGGG + Intergenic
1177033340 21:16010966-16010988 CCTTTCATCCAGGAGCTAAAAGG - Intergenic
1177265271 21:18775119-18775141 CCATTGCTCCAGGAGCAGGAGGG - Intergenic
1179317851 21:40260889-40260911 CCCGACATCCAGGAGCTGGCTGG + Intronic
1179469496 21:41601196-41601218 CCCACCATCCAGCAGCTGGAGGG + Intergenic
1179979831 21:44890151-44890173 CGGAGCAGCCAGGAGCTGGAAGG - Exonic
1181483449 22:23215870-23215892 CAGTTAATCCAGGAGTTAGATGG + Intronic
1182277706 22:29201010-29201032 CCATTCATCCTGGAGCTGTCAGG + Intergenic
949875279 3:8622645-8622667 CGGATCATCTTGGAGCTGGAAGG - Intronic
951390180 3:22093005-22093027 CCCAGCATCCAGGAGCAGGAAGG + Intronic
954876611 3:53806500-53806522 CTGTTCAGCCAAGGGCTGGAAGG - Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
960277311 3:115742606-115742628 CGGCCCATCCAGGAGCTGAATGG - Intergenic
961734563 3:128993442-128993464 GCGTTCATCTAGGAGCAGGCGGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
985909379 5:2866879-2866901 CCTTTCCTCCCGGAGCTGGCAGG - Intergenic
987253822 5:16127835-16127857 CCGTTCAACCAGAAGCCAGAGGG - Intronic
989422560 5:41256794-41256816 CCTTTTATCAAGGAGCTGGCTGG - Intronic
995048040 5:107671743-107671765 CGGCCCATCCAGGAGTTGGAGGG - Intergenic
998210399 5:140192830-140192852 GGGTTCACCCTGGAGCTGGATGG + Intronic
1001030332 5:168257908-168257930 CCTTTCAATCAGGAGCTGGCCGG - Intronic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1005601545 6:27431254-27431276 GGGTTCATCCATGACCTGGAGGG + Intergenic
1017153905 6:151305909-151305931 CCGCCCCTCCAGGAACTGGAAGG + Intronic
1019428348 7:987665-987687 GCGTCCAGCCAGGAGCAGGAGGG + Intronic
1021801499 7:24311408-24311430 CCCTTCACCCAGTGGCTGGATGG - Intergenic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1024953271 7:54888252-54888274 CCGCTCTGCCGGGAGCTGGAAGG - Intergenic
1027332693 7:77115927-77115949 CAGTTCACCCAGGCCCTGGAAGG - Intergenic
1029783089 7:102755389-102755411 CAGTTCACCCAGGCCCTGGAAGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031490431 7:122381143-122381165 GCTTTCAGCCAGGAGCTGGGGGG - Intronic
1034989151 7:155536647-155536669 CTGTTCATCCAGCAGGTGGATGG - Intergenic
1036810725 8:11866533-11866555 CCCTTTCTCCAGGAGCTGGCGGG + Intronic
1040071369 8:43191525-43191547 CTGCTCATCCTGGTGCTGGAAGG + Exonic
1049493507 8:142917305-142917327 CCGCTAATCCAGGAGCAGGGAGG - Intronic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1051509810 9:17865052-17865074 CCCTTCATCCAGGACCAGAAGGG - Intergenic
1051922212 9:22280594-22280616 CCATCCATCCAAGAGCTAGAAGG - Intergenic
1053554081 9:39116310-39116332 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1053818184 9:41936435-41936457 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1054108443 9:61080094-61080116 CTGAACAGCCAGGAGCTGGAGGG + Intergenic
1054612414 9:67251031-67251053 CTGAACAGCCAGGAGCTGGAGGG - Intergenic
1054871771 9:70053772-70053794 CTGTTCATTCAGGAGCTGTGAGG + Intronic
1059423921 9:114209249-114209271 CCCTACATCCAGGACCTTGAAGG + Intronic
1060934249 9:127506434-127506456 CCACTCACCCAGGAGCTGGCTGG - Exonic
1062332990 9:136052684-136052706 CCGGGCAACCAGGAGCCGGAAGG + Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1185871500 X:3668605-3668627 GCGGTCATCCAGGAACTAGAAGG + Intronic
1189148103 X:38675774-38675796 TCGTTCATGCAGCAGCTGGGGGG - Exonic
1189190446 X:39097369-39097391 CCCTTATTCCAGGAGCAGGAAGG - Intergenic
1190745739 X:53320978-53321000 CGGCGCATCGAGGAGCTGGAGGG - Exonic
1191033241 X:55997754-55997776 CCCTTCATCCAGAATCTGCAAGG - Intergenic
1201928564 Y:19316727-19316749 CAGTCCATCCAGAAGCTGCACGG + Intergenic