ID: 954998718

View in Genome Browser
Species Human (GRCh38)
Location 3:54906421-54906443
Sequence TTCATGTCACCTCATCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954998718 Original CRISPR TTCATGTCACCTCATCAGGG AGG (reversed) Intronic
901154806 1:7128378-7128400 TAAATGTCACCTCAGCAGGGAGG - Intronic
901567749 1:10132781-10132803 CAAATGTCACCTCCTCAGGGAGG - Intronic
901690736 1:10971570-10971592 TAAATGTCACCTCCTCTGGGAGG + Intronic
904205900 1:28855186-28855208 CAAATGTCACCTCCTCAGGGAGG - Intronic
904358612 1:29958244-29958266 TTTATGTCAGCTGGTCAGGGAGG + Intergenic
905263096 1:36732911-36732933 CTCATGAAACCTCATAAGGGAGG - Intergenic
905451320 1:38058668-38058690 CCCATGTCACATCCTCAGGGAGG - Intergenic
906456246 1:45999712-45999734 TAAATGTCACCTCCTCAGAGAGG + Intronic
906777939 1:48546977-48546999 TTCATATCCCCTCCTCAGAGAGG - Intronic
907976447 1:59435633-59435655 TCAATGTCACCTCCTCAGAGTGG + Intronic
910123237 1:83813427-83813449 CAAATGTCACCTCCTCAGGGAGG - Intergenic
912869832 1:113293914-113293936 ATCACCTCATCTCATCAGGGTGG + Intergenic
915960754 1:160264484-160264506 TAGATGTCACCTCAGCAGAGGGG - Intergenic
916063113 1:161115608-161115630 TTCACCTTACCTCATCAGGAAGG + Intronic
916120014 1:161521059-161521081 CACATGTCACCTTATCAGTGAGG + Intronic
916129769 1:161602708-161602730 CACATGTCACCTTATCAGTGAGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918386125 1:184010023-184010045 TTGCTGTCACTTCATCAAGGGGG + Intronic
918525803 1:185463574-185463596 TAAATGTCACCTCTTCAGAGAGG + Intergenic
918576916 1:186072634-186072656 TAAATGTCACCTTATCAGTGAGG - Intronic
920216651 1:204365916-204365938 CCCATGTCACCTCCTCAGAGAGG - Intronic
923319947 1:232821298-232821320 TAAATGTCACCTCTTCAGAGAGG + Intergenic
923805458 1:237252382-237252404 TTAGTGTCCCCTCATCAGAGAGG + Intronic
1063202586 10:3798245-3798267 CAAATGTCACCTCATCAGGGAGG - Intergenic
1063491730 10:6470409-6470431 TGCGTGTCACCTCCTCAGGATGG + Intronic
1063515137 10:6688033-6688055 TTCATGTCACCCCATGTGGCTGG + Intergenic
1063576528 10:7266594-7266616 GGCATGTCATCTCATCAGGGCGG - Intronic
1064582901 10:16811954-16811976 TTCCTGTGACCTCCTCAAGGAGG - Intronic
1065571429 10:27073980-27074002 TTCAAGTCACATCCTCAAGGGGG + Intronic
1065666729 10:28071205-28071227 CTCCTGTGACCTCCTCAGGGTGG - Intronic
1067136074 10:43608363-43608385 TTCATGTCACCTCATCAAAAAGG - Intronic
1068022597 10:51603833-51603855 TTCATGTCACCTCCTCCAAGAGG - Intronic
1068110630 10:52676094-52676116 TTCTTGTCACCACTTCAGAGAGG - Intergenic
1069479680 10:68770125-68770147 TAAATGTCACCTTATCAGAGAGG + Intronic
1069993465 10:72328898-72328920 CTCCTGCCACCTCCTCAGGGAGG - Intergenic
1071964544 10:90838803-90838825 TACATGTCACCTCCTCAGAAAGG + Intronic
1073155358 10:101342096-101342118 TTCATGGCAGCCCAGCAGGGAGG - Intergenic
1073469412 10:103713613-103713635 TGAATGCCACCTCCTCAGGGAGG + Intronic
1077560366 11:3256676-3256698 TTCAGGACACCTCAGCATGGAGG - Intergenic
1077566263 11:3302493-3302515 TTCAGGACACCTCAGCATGGAGG - Intergenic
1078550584 11:12277477-12277499 TAAATGTCACCTCCTCTGGGAGG - Intronic
1079355421 11:19726523-19726545 TTGATGTTACCTTATCAGAGAGG + Intronic
1081547812 11:44084085-44084107 TTCTTTTCACATCCTCAGGGGGG - Exonic
1081576679 11:44323044-44323066 ATCATGACACCTTATCAGGAAGG + Intergenic
1081715218 11:45245228-45245250 TTCATGTCACATCACAAGGCTGG + Intronic
1081889482 11:46528836-46528858 GTCATTTCACCTCAGCAAGGTGG - Intronic
1083184457 11:61009089-61009111 TTAATGTCACCTCTTCCGGGAGG - Intronic
1084268124 11:68015275-68015297 TTCATGCCACCCCATCTGGCAGG + Exonic
1084565193 11:69924578-69924600 TGCATGTCACTTCCTCAGAGAGG + Intergenic
1084958985 11:72706347-72706369 GGCATGTCACCTCCTCAGAGAGG + Intronic
1085728198 11:78973857-78973879 TAAATGTCACCTCCTCAGGGAGG - Intronic
1088795699 11:113265188-113265210 TTCATGTGAACTCACCAGCGTGG + Intronic
1089628290 11:119765694-119765716 TTAATGTCATCGCCTCAGGGAGG + Intergenic
1091379979 12:51303-51325 TTCATGTCATCTCAACACGGGGG + Intergenic
1092090530 12:5800107-5800129 TCAATGTCACCTCCTCAGAGAGG - Intronic
1092227573 12:6757973-6757995 TAAATGTCACTTCATCAGTGAGG - Intronic
1096855458 12:54478695-54478717 TTAATGTCAGCACTTCAGGGGGG - Intergenic
1097179042 12:57160486-57160508 CTCATGCCACCTCCTCATGGTGG + Intronic
1098426653 12:70371996-70372018 TAAATGTCACTTCATCAGAGCGG - Intronic
1098562237 12:71887636-71887658 TTAATGTCACTTCCTCAGAGGGG + Intronic
1099325698 12:81212054-81212076 TAAATGTCACCTTCTCAGGGAGG + Intronic
1099719486 12:86342306-86342328 TCCATGTCTCCTCAGCAGGCAGG + Intronic
1101306850 12:103536810-103536832 TAAATGCCACCTCATCAGCGAGG + Intergenic
1101657975 12:106740819-106740841 TAAATGTCACCTTGTCAGGGAGG - Intronic
1102297687 12:111749542-111749564 TTCAGGTCACCTCGACAGAGTGG - Intronic
1102566144 12:113798676-113798698 TGACTGTCACCTCATCAGCGAGG + Intergenic
1102811354 12:115826954-115826976 CAAATGTCACTTCATCAGGGAGG + Intergenic
1103060218 12:117852651-117852673 TTCATGTTGTCTCATCCGGGAGG - Intronic
1103103152 12:118198298-118198320 TAAATGTCACCTCATCAGGTAGG + Intronic
1104174628 12:126318132-126318154 TTCATGTCCCCCCTTGAGGGAGG + Intergenic
1106367103 13:29092007-29092029 TTCATCTTACCTCTTCAGGGTGG - Intronic
1106484935 13:30163654-30163676 TTCTTGTAACCTCTTCAGTGTGG + Intergenic
1106577402 13:30988207-30988229 TTGCTGTTACCTCATTAGGGTGG + Intergenic
1106974249 13:35187974-35187996 TTCAGGTCACCTCCTCCGAGAGG + Intronic
1111817564 13:93173018-93173040 TTCAAAGCACTTCATCAGGGTGG - Intergenic
1112228364 13:97563618-97563640 TTCATGCAACCCCATGAGGGAGG + Intergenic
1116577839 14:46597734-46597756 CTCATGTCACCTAATCAGAGAGG + Intergenic
1116960742 14:50965726-50965748 TTCATATAACCTCAGCAGGCTGG + Intergenic
1119189573 14:72671326-72671348 TACATGTCAGCTCATTTGGGAGG - Exonic
1119643654 14:76332164-76332186 TACATGTCACCTCTGCAGGGAGG - Intronic
1126556219 15:49990477-49990499 TTCATGTCTTCTCTTCAGAGGGG - Intronic
1127253102 15:57263195-57263217 TTCATGTCATCTGATGAAGGAGG - Exonic
1129525501 15:76211274-76211296 TGTATGTCACCCCATCAGTGGGG + Intronic
1130179586 15:81611599-81611621 CACATGTCACTTCCTCAGGGAGG + Intergenic
1130555995 15:84922894-84922916 CTAATGTCACCTCCTCAGAGAGG + Intronic
1132043489 15:98545487-98545509 CTCATGTTACCTCCTCAGAGAGG + Intergenic
1132411114 15:101578872-101578894 TGCATGTCACCTGGACAGGGAGG - Intergenic
1132673266 16:1110858-1110880 CTCAAGTCACCACATCAGGGCGG - Intergenic
1133218391 16:4307368-4307390 CTCAAGTCACCTCCCCAGGGAGG + Intergenic
1135789236 16:25378178-25378200 TTGATGTCTGCTCATCATGGAGG + Intergenic
1136065958 16:27758742-27758764 CAAATGTCACCTCCTCAGGGAGG + Intronic
1136082083 16:27858913-27858935 TAAATGTCACCTTCTCAGGGAGG - Intronic
1137435087 16:48448292-48448314 TTCATGACCCCTCTCCAGGGAGG + Intronic
1137498968 16:48995984-48996006 TGTATGTCACCTCCTCAGGGTGG - Intergenic
1137563676 16:49519978-49520000 TGCATGCCACCTCCTCGGGGAGG + Intronic
1138577029 16:57914624-57914646 GTCCTGTCACGTGATCAGGGTGG - Intronic
1140263042 16:73397200-73397222 TAAATGTCACCTCCTCAGAGAGG - Intergenic
1140557891 16:75942573-75942595 TTCTTGTCACCTCCTCAAAGAGG - Intergenic
1141718496 16:85741297-85741319 TTCCAGACACCTCTTCAGGGAGG - Intronic
1142518506 17:489500-489522 CTCATGTCACCTCCTCTGGGAGG - Intergenic
1143010664 17:3864709-3864731 TTTCTGTCATCTCTTCAGGGAGG - Intronic
1144961104 17:19044650-19044672 TCCATGTCACTTCTTCAGAGAGG - Intronic
1144974057 17:19129874-19129896 TCCATGTCACTTCTTCAGAGAGG + Intronic
1145254753 17:21316433-21316455 CCCATGTCACCTCCTCAGCGAGG + Intergenic
1145321847 17:21771532-21771554 CCCATGTCACCTCCTCAGCGAGG - Intergenic
1146502388 17:33375218-33375240 CAAATGTCACCTCATCAGTGGGG - Intronic
1146815494 17:35938827-35938849 TTAATGTCATCTCCTCAGAGAGG + Intronic
1148666998 17:49382446-49382468 TTCATCTCATCTCAGCAGGCAGG + Intronic
1149501850 17:57158770-57158792 TTCATTGCACCTGATCAGGGAGG + Intergenic
1150904313 17:69321282-69321304 TTCATGTCACCTCTGCTGTGTGG - Intronic
1151078645 17:71303197-71303219 TTTATGTCACCTAAACATGGTGG - Intergenic
1153757920 18:8302218-8302240 TCCATGTCCCATCCTCAGGGAGG - Intronic
1154041320 18:10859133-10859155 TAAATGTCACCTCCTCAGAGAGG - Intronic
1157575147 18:48738608-48738630 TCCATGTCACCTTCTCAGGGAGG + Intronic
1159758477 18:72395042-72395064 TTTGTGTCACCCCACCAGGGAGG + Intergenic
1161497070 19:4592481-4592503 TCAATGTCACCTCCTCAGAGAGG - Intergenic
1161645357 19:5450106-5450128 CATATGTCACCTCCTCAGGGAGG + Intergenic
1162421980 19:10570779-10570801 CAAATGTCACCTCTTCAGGGAGG - Intergenic
1163518214 19:17777668-17777690 TCCAAGTCACCCCCTCAGGGAGG - Intronic
1164203746 19:23040770-23040792 TTCATGTGACCTAAGCAAGGGGG - Intergenic
1165132987 19:33644863-33644885 CTCATCTCACCTTCTCAGGGAGG - Intronic
1165454935 19:35904888-35904910 CTCACGTCACCTCCTCAGAGAGG + Intronic
1166054431 19:40279957-40279979 CACACGTCACCTCCTCAGGGAGG + Intronic
1166233677 19:41440980-41441002 TCAATGTCACCTCTTCAGAGAGG - Intergenic
926783193 2:16494500-16494522 TAGATGTCATCTCCTCAGGGAGG + Intergenic
927040044 2:19219961-19219983 TTCATGCCACCTCATCATGAAGG + Intergenic
927853371 2:26513521-26513543 TTCATTTCACCCCATCAGCCAGG + Intronic
928373472 2:30757592-30757614 AGCATGTCACATCATCAGGGTGG - Intronic
930226479 2:48799404-48799426 TTCATTTTAACTCATCTGGGAGG + Intergenic
930843771 2:55879006-55879028 CAAATGTCACCTCCTCAGGGTGG + Intronic
934062011 2:88303578-88303600 TTCAAGTCACCTTTTCAGTGAGG + Intergenic
936167490 2:110135898-110135920 TTGCTGTCACCTCATCACAGTGG - Intronic
936563894 2:113567541-113567563 TTCATGTCATCTCAACACAGGGG - Intergenic
938903287 2:135816567-135816589 TTCATTTAGCCTGATCAGGGTGG - Intronic
940216398 2:151307907-151307929 TCAATGTCACCTCCTCAGAGAGG + Intergenic
941689503 2:168484535-168484557 TACATGTCACCTTACCAGTGTGG - Intronic
942716407 2:178897595-178897617 TTCATTCTACCTCATCATGGCGG - Intronic
943585917 2:189739924-189739946 TTCATTTCTCCTCATCCTGGAGG - Intronic
946993291 2:225360326-225360348 TTCATATAACCTCTTCAGGGAGG - Intergenic
1168761330 20:351824-351846 AAAATGTCACCTCCTCAGGGAGG + Intronic
1170071552 20:12374673-12374695 CTGATCTCACCTCATCAGAGGGG - Intergenic
1170278883 20:14623906-14623928 TTCTTCTCATCTTATCAGGGAGG + Intronic
1170304666 20:14925032-14925054 TTCACTTCTCCTCATCAGGCAGG + Intronic
1172068313 20:32237419-32237441 TTCATGACAGCTCTTCAGAGAGG - Exonic
1172115130 20:32569186-32569208 GAAATGTCACCTCCTCAGGGAGG - Intronic
1172475504 20:35234530-35234552 TGAATGCCACTTCATCAGGGAGG - Intronic
1172964605 20:38825551-38825573 ATCTAGTCACCTTATCAGGGTGG + Intronic
1173077894 20:39837884-39837906 TAAATGTCACCTCTTCAGTGAGG - Intergenic
1173723990 20:45284108-45284130 CTCTTGCCACTTCATCAGGGTGG - Intergenic
1174062380 20:47841930-47841952 CACATGTCACCTCCTCAGAGAGG + Intergenic
1174150821 20:48485071-48485093 CACATGTCACCTCCTCAGAGAGG + Intergenic
1174205523 20:48835519-48835541 TAAATGTCACCTTCTCAGGGAGG - Intergenic
1174253193 20:49234683-49234705 CTAATGTCACCTCTTCAGAGAGG + Intronic
1175135196 20:56818315-56818337 TTCCTGTCACCTCCGCAGAGAGG + Intergenic
1175722111 20:61293825-61293847 TTCCTGGCCCCTCACCAGGGTGG + Intronic
1175772225 20:61631007-61631029 TCAATGTCACCTCCTCAGAGAGG - Intronic
1175909417 20:62397558-62397580 GTCATGTCTCCGCATCAGGATGG - Intronic
1177762148 21:25414173-25414195 TTCATATCTCCTCATCATAGAGG + Intergenic
1177859279 21:26434175-26434197 TTAATGTCAGCACATCAAGGAGG + Intergenic
1179509850 21:41865229-41865251 TTAACGTCACTTCTTCAGGGAGG + Intronic
1182920345 22:34073391-34073413 CAAATGTCACCTCCTCAGGGAGG + Intergenic
1184717264 22:46289269-46289291 GTCACCTCACCTCATCAGTGTGG + Intronic
950590341 3:13932381-13932403 CCAATGTCACCTCCTCAGGGAGG + Intergenic
950672798 3:14537280-14537302 GAAATGTCACCTCCTCAGGGAGG + Intronic
950710423 3:14809955-14809977 CCAATGTCACCTCCTCAGGGAGG + Intergenic
950719297 3:14871095-14871117 TGAATGTCACCTCCTCAGAGAGG + Intronic
950798394 3:15529995-15530017 CCGATGTCACCTCCTCAGGGAGG - Intergenic
951599930 3:24362421-24362443 TTCCTGTCACCTTCTCAGTGAGG + Intronic
952988547 3:38810505-38810527 TAAATGTCACTTCATCAGGGAGG + Intergenic
953781428 3:45874515-45874537 TAAATGTCACCTCCTCAGAGAGG + Intronic
954142967 3:48619849-48619871 TCCTTGTCACCACCTCAGGGAGG - Intergenic
954930913 3:54280577-54280599 TTCATGTCACCTCCTCCCTGAGG - Intronic
954994358 3:54867894-54867916 TTCATGTGGCCTGATCAGTGGGG - Intronic
954998718 3:54906421-54906443 TTCATGTCACCTCATCAGGGAGG - Intronic
955237882 3:57155922-57155944 GACATGTCACCTCCTCAGAGAGG + Intronic
955386761 3:58486921-58486943 ATATTGTCACCTCCTCAGGGAGG - Intergenic
955398173 3:58572402-58572424 TTAATGTCGCCTCCTCAGAGAGG - Intronic
955536162 3:59925746-59925768 TTTATGTCACGATATCAGGGTGG - Intronic
956093932 3:65696204-65696226 TTCAACTCACCTTATCAAGGAGG + Intronic
956883364 3:73533838-73533860 TGCAGGTCACCTCTTCAGTGAGG + Intronic
957773513 3:84724970-84724992 TTCATTTCATCTCATCATGTAGG - Intergenic
957790089 3:84929524-84929546 TTTATGGCACCTCCTCAGAGTGG + Intergenic
958261672 3:91388706-91388728 TTCATGTAATCTCTTCAGAGCGG + Intergenic
958888447 3:99755642-99755664 CACATGTCACCTCCTCAGAGTGG - Intronic
961060449 3:123823980-123824002 TACATATCACCTCCACAGGGGGG + Intronic
961583717 3:127904462-127904484 TTCAGGTCACCTCCTCAGAGAGG + Intergenic
961911975 3:130327009-130327031 ATCAAGTCACATCATCAGAGAGG + Intergenic
961995553 3:131238159-131238181 TATATGTCATCTTATCAGGGAGG + Intronic
964434232 3:156635231-156635253 TAAATGTCACCTCCTCAGAGAGG + Intergenic
964811185 3:160666373-160666395 TACATGTCACCTCTTCTGGGAGG + Intergenic
966425857 3:179778912-179778934 CAAATGTCACCTCATCAGAGAGG - Intronic
967908059 3:194517978-194518000 TTGATGTCAGCCCTTCAGGGAGG + Intergenic
969063572 4:4459569-4459591 TAAATGTCACCTGATCAGGGAGG - Intronic
969971639 4:11054018-11054040 ATCATTCCACCTCTTCAGGGAGG + Intergenic
970670613 4:18392320-18392342 CCCATGTCACCTCCTCAGTGAGG + Intergenic
971405291 4:26317254-26317276 CTGATGTCACCTCCTCAGGGAGG - Intronic
972118754 4:35673935-35673957 TTTTTGTGACCTCATCAGAGAGG - Intergenic
972252810 4:37322346-37322368 TTAATGCCACCTCCTCAGAGAGG - Intronic
972859172 4:43146240-43146262 TTCATGTCCCATCTTCAGGGAGG + Intergenic
973323030 4:48829617-48829639 TTGATGTCACCACATCAGAGAGG - Intronic
979669136 4:123343853-123343875 TTCAGGTCACCTCAGCCTGGTGG + Intergenic
981527208 4:145718915-145718937 TAAATGTCACCTCTTCAGAGAGG + Intronic
982073256 4:151714275-151714297 TCAGTGTCACCTCTTCAGGGTGG + Intronic
982859228 4:160428154-160428176 TTCCTGTCACCTCATGAAGAAGG - Intergenic
987301698 5:16603462-16603484 TTCCTGTCACCTCTTCAGCGAGG - Intronic
988588434 5:32527945-32527967 TTCATGTCACCTTCTCAGAGAGG + Intergenic
991292633 5:65047411-65047433 TAAATGTCACCTCCTCAGAGAGG + Intergenic
992042111 5:72845903-72845925 TGAATGTCACCTCAGCAGGTAGG + Intronic
992087542 5:73291412-73291434 TTCACGTCACCTCTTCAGAAAGG + Intergenic
992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG + Intergenic
992733357 5:79693942-79693964 CAAATGTCACCTCATCAGAGAGG - Intronic
995159530 5:108962362-108962384 CAAATGTCACTTCATCAGGGAGG + Intronic
995755818 5:115502938-115502960 TAAATGTCACCTCCTCAGAGGGG + Intergenic
996281967 5:121740921-121740943 TCCATGTTACCTCCTCAGAGAGG - Intergenic
998847886 5:146328509-146328531 CAAATGTCACCTCATCAGAGAGG - Intronic
999135957 5:149319363-149319385 CAAATGTCACCTCCTCAGGGAGG - Intronic
999963168 5:156778812-156778834 CAGATGTCACCTCCTCAGGGAGG - Intergenic
1000231496 5:159319665-159319687 TAAATGTCACCTCCTCAGAGAGG + Intronic
1000348316 5:160332707-160332729 TCCATGTCATCTTAGCAGGGGGG + Intronic
1001517083 5:172363580-172363602 GTTATGTCACCTCCTTAGGGAGG - Intronic
1001522238 5:172403027-172403049 CCCATGGCACCTCACCAGGGAGG - Intronic
1006797202 6:36739346-36739368 CTCATGTCACCTCACCACAGGGG - Intergenic
1008993489 6:57631439-57631461 TTCATGTAATCTCTTCAGAGCGG - Intronic
1009182094 6:60530526-60530548 TTCATGTAATCTCTTCAGAGCGG - Intergenic
1009533436 6:64850440-64850462 TTCAAGTTACTTCTTCAGGGAGG - Intronic
1010109795 6:72213139-72213161 TTCATGTCTCTTCAGAAGGGTGG + Intronic
1010304928 6:74308813-74308835 TTAAAGTCACATCATTAGGGTGG - Intergenic
1011388996 6:86830218-86830240 AACATGTCTCCTCCTCAGGGAGG + Intergenic
1012026166 6:93994642-93994664 TTCATGTAACCTTTTAAGGGTGG + Intergenic
1013481698 6:110558465-110558487 TTCCTGGCACCTCTTCAGTGTGG - Intergenic
1014512855 6:122345986-122346008 TACACGTCACCCCATCAGGGAGG + Intergenic
1014768553 6:125435175-125435197 TTCATGTTGGCTCATCAAGGAGG - Intergenic
1016163753 6:140913695-140913717 TACATGTGACTTCTTCAGGGTGG + Intergenic
1016237689 6:141887791-141887813 ACCAAGTCACTTCATCAGGGTGG - Intergenic
1017278882 6:152602237-152602259 TTCAAGTAAGCTCATTAGGGTGG + Intronic
1017791750 6:157805671-157805693 TTTATTTCACCTCCTCAGGTGGG - Intronic
1018696536 6:166395810-166395832 TAGATGTCACCTCCTCAGAGAGG - Intergenic
1019359019 7:595276-595298 TCAATGCCACCTTATCAGGGGGG + Intronic
1019509399 7:1409845-1409867 TTAATGTGAGCTCATTAGGGTGG - Intergenic
1019908267 7:4081317-4081339 TGCATTTCAGCTCATCTGGGAGG + Intronic
1020643831 7:10789386-10789408 TTGATGTGACACCATCAGGGTGG + Intergenic
1023095494 7:36655951-36655973 TACATGTCACTTCTTCAGGGAGG - Intronic
1023559761 7:41461662-41461684 TCCATGTCACCCCTTCAGGCAGG - Intergenic
1023616984 7:42029733-42029755 TAAATGTCACCTCCTCAGAGGGG + Intronic
1024632923 7:51263968-51263990 TTCATGACAGCTCACAAGGGAGG + Intronic
1028445736 7:90921339-90921361 TTCATGTCACCTCTTCAAAGGGG + Intronic
1029131174 7:98332430-98332452 TTAATGTCACCTTTTCAGTGAGG + Intronic
1029409323 7:100398610-100398632 TTCAGGTCTTCTGATCAGGGAGG - Intronic
1030658970 7:112199228-112199250 TTCATGATACCTCATGAAGGAGG - Intronic
1031611223 7:123829968-123829990 TTCAAGACATCTCATCAGAGAGG - Intronic
1031649356 7:124267418-124267440 TACATGTCACCTCAGCAAGATGG + Intergenic
1032159705 7:129501334-129501356 TTAACGTCACCTCCTCAGAGAGG + Intergenic
1032306791 7:130741471-130741493 TTCAGTTCACCTCATCAGAACGG - Intergenic
1033550466 7:142442391-142442413 TTCAGGACACAGCATCAGGGAGG - Intergenic
1034428210 7:151026010-151026032 TTGTTGTCACCTCAACAAGGAGG + Intergenic
1038248921 8:25884454-25884476 TCCATGTCCCCTCTTCAGAGAGG + Intronic
1039846002 8:41325978-41326000 TAAATGTCACGTCTTCAGGGAGG - Intergenic
1040516226 8:48137295-48137317 TTCTGGTCACCATATCAGGGAGG - Intergenic
1040949207 8:52919209-52919231 TGAATGTGACCTCATCAGAGAGG + Intergenic
1041544864 8:59031674-59031696 TAAATGTCACCTCCTCAGAGAGG - Intronic
1042019823 8:64359867-64359889 TTCAAGTTACATCATAAGGGAGG + Intergenic
1042166372 8:65949842-65949864 CTCATGTCACCTCTTCAGAAAGG - Intergenic
1045352898 8:101358783-101358805 TTCCTTTCATCTCATCATGGAGG - Intergenic
1046038302 8:108871952-108871974 TTCATGTCATCTTCTCAGAGAGG - Intergenic
1048940705 8:139398152-139398174 TTCATGTCAGCTCTTCAGAGAGG - Intergenic
1049163676 8:141113324-141113346 TTCTTGTCACCTCACCACGCTGG - Intergenic
1052083445 9:24235168-24235190 CTCATGTCACAAGATCAGGGTGG - Intergenic
1057457629 9:95228705-95228727 TGGATGTCACCTCCTCATGGAGG - Intronic
1061221937 9:129257254-129257276 TAAAGGTCACCTCCTCAGGGAGG + Intergenic
1061759770 9:132842517-132842539 TTCAAGTCACTTCTTCAGGGAGG - Intronic
1185765702 X:2724243-2724265 ACTATGTCACTTCATCAGGGAGG + Intronic
1187466012 X:19528396-19528418 CCAATGTCACCTCATCAGAGAGG - Intergenic
1188012115 X:25068321-25068343 TAAATGTCACCTCTTCAGAGAGG - Intergenic
1188039289 X:25353419-25353441 CTGATGTCACCTCCTCAGAGTGG + Intergenic
1188456477 X:30372422-30372444 TTCATCTCTCCTCATCAGCGGGG - Intergenic
1189136563 X:38556738-38556760 TAAATGTCACCTCCTCAGAGAGG - Intronic
1190216442 X:48482238-48482260 TTCAGATCACCTCCTCGGGGAGG - Intronic
1194832179 X:98637081-98637103 TACTTGTCACCTTATCAGAGAGG + Intergenic
1195317694 X:103694853-103694875 TAAATGTCACTTCCTCAGGGAGG + Intergenic
1195369148 X:104156133-104156155 TCCAGTTCACCTCAACAGGGAGG + Intronic
1196763001 X:119216734-119216756 TTCATTTCAGCTCTTCAGTGTGG - Intergenic
1198273399 X:135077296-135077318 TTTATGTAAACTTATCAGGGTGG + Intergenic
1199413437 X:147552617-147552639 TGAATGTCACCTCTTCAGAGAGG + Intergenic
1201669192 Y:16497550-16497572 GTCATGTTTCCTCATCAGGGAGG + Intergenic