ID: 954998842

View in Genome Browser
Species Human (GRCh38)
Location 3:54907419-54907441
Sequence AGATTCAGTCTTGCGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954998834_954998842 26 Left 954998834 3:54907370-54907392 CCAGAGAAAAGGGAAGGAATTAA 0: 1
1: 0
2: 3
3: 47
4: 504
Right 954998842 3:54907419-54907441 AGATTCAGTCTTGCGTTTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 92
954998836_954998842 3 Left 954998836 3:54907393-54907415 CCAATACTGGAATATGTCTTAGA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 954998842 3:54907419-54907441 AGATTCAGTCTTGCGTTTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 92
954998833_954998842 29 Left 954998833 3:54907367-54907389 CCACCAGAGAAAAGGGAAGGAAT 0: 1
1: 0
2: 4
3: 39
4: 424
Right 954998842 3:54907419-54907441 AGATTCAGTCTTGCGTTTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954998842 Original CRISPR AGATTCAGTCTTGCGTTTGG GGG Intronic