ID: 954999075

View in Genome Browser
Species Human (GRCh38)
Location 3:54910045-54910067
Sequence TTGCACTTACCAAGAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954999071_954999075 -5 Left 954999071 3:54910027-54910049 CCCAATGTCTCCCAAAGTTTGCA 0: 1
1: 0
2: 2
3: 30
4: 204
Right 954999075 3:54910045-54910067 TTGCACTTACCAAGAACTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
954999072_954999075 -6 Left 954999072 3:54910028-54910050 CCAATGTCTCCCAAAGTTTGCAC 0: 1
1: 0
2: 1
3: 7
4: 164
Right 954999075 3:54910045-54910067 TTGCACTTACCAAGAACTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954999075 Original CRISPR TTGCACTTACCAAGAACTCC TGG Intronic
907702581 1:56803723-56803745 TTGCAGTCACGTAGAACTCCTGG + Intronic
908095625 1:60734259-60734281 TTGCACTTAACAGTATCTCCTGG - Intergenic
915282924 1:154834968-154834990 TTCCACATCCCCAGAACTCCCGG + Intronic
915459295 1:156060297-156060319 TATCTCTTACCAAGACCTCCTGG + Intergenic
915459536 1:156061531-156061553 TATCTCTTACCAAGACCTCCTGG + Intronic
917058365 1:171008817-171008839 TTTCACTTAACAACATCTCCTGG - Intronic
921537703 1:216372244-216372266 TTGCATTTTCCATGAGCTCCTGG + Intronic
922603698 1:226875538-226875560 CTGCACTTACCACGAACACTTGG - Exonic
1063513778 10:6673369-6673391 ATGCAATTAGCAAGAACTGCAGG - Intergenic
1068622104 10:59197731-59197753 TTACAATTACCAACAATTCCAGG + Intronic
1068697279 10:59981381-59981403 TTACTTTTAACAAGAACTCCAGG + Intergenic
1069846040 10:71372434-71372456 CTGCATTTACCAAGTGCTCCAGG - Intergenic
1070206659 10:74270470-74270492 TTGAACTGATCCAGAACTCCTGG + Intronic
1071008657 10:80912426-80912448 TTGGACTTTCCAAGAACTCTAGG + Intergenic
1072449605 10:95529522-95529544 CTGCATTTATCAAGCACTCCAGG - Intronic
1073300440 10:102468000-102468022 TTGCATTTCCCAAGACCACCCGG - Intronic
1073791806 10:106948061-106948083 TTTCACTTACCAATGACTCTTGG - Intronic
1075191940 10:120317188-120317210 TTTCACTTACCCAGAAATTCAGG + Intergenic
1075387291 10:122064574-122064596 TTGCAGTTTCCAAGAACCACTGG + Intronic
1075855348 10:125625092-125625114 TTGCACCTCCCCAGTACTCCAGG + Intronic
1081260675 11:40956470-40956492 ATGTATTTACCAAGAACTCTTGG + Intronic
1083815311 11:65129573-65129595 CAGGAGTTACCAAGAACTCCTGG + Intronic
1084719182 11:70893159-70893181 TAGCACTTACCAAGTACTACAGG - Intronic
1086064051 11:82728569-82728591 TTGCACTTAAAAAGAATTCTTGG + Intergenic
1086077214 11:82867302-82867324 TTCCTCAAACCAAGAACTCCTGG + Intronic
1087261092 11:96013549-96013571 TTGCATTTCCCAAGACCACCTGG + Intronic
1087862868 11:103184375-103184397 TGGCACTTACCAGGGACCCCAGG + Intronic
1090378743 11:126310247-126310269 TTGACCTCTCCAAGAACTCCGGG + Intronic
1091842897 12:3633355-3633377 TTGGACTTACAAAGTACTCAGGG + Intronic
1109075690 13:57832181-57832203 TTGCATTTTCCAAGACCACCTGG + Intergenic
1111921454 13:94415959-94415981 ATGCTCTGACAAAGAACTCCTGG - Intergenic
1114866374 14:26598746-26598768 ATGCACCTAGCAAGAAGTCCTGG - Intergenic
1118929295 14:70225407-70225429 TTGCATTTCCCAAGACCACCTGG + Intergenic
1119871937 14:78025427-78025449 TTGTACTTTCCATGAACACCAGG - Intergenic
1126982082 15:54255670-54255692 TTGCATTTCCCAAGAAACCCTGG - Intronic
1129840651 15:78741428-78741450 TTGCATTTAACAAGATTTCCAGG - Intergenic
1130513639 15:84608907-84608929 TTGCATTTGACAAGATCTCCAGG + Intronic
1133464983 16:6019980-6020002 CTGGACTTACCTAGAACTCCCGG - Intronic
1133545297 16:6800429-6800451 TTGCATTTAGCAAGATCCCCAGG - Intronic
1134156774 16:11850769-11850791 TAGCATTTACTGAGAACTCCTGG + Intronic
1134624747 16:15715469-15715491 TTTCACTTGGCAAGAATTCCAGG - Intronic
1138026464 16:53526008-53526030 TTTTATTTACCAAGAACTGCAGG + Intergenic
1138477556 16:57281094-57281116 TCTCACTGACCAAGAGCTCCTGG + Intronic
1139063298 16:63281969-63281991 TGACACTTAACAAGACCTCCTGG + Intergenic
1141147220 16:81539687-81539709 TTGCTCTTAGCAGGAACTGCGGG - Intronic
1141513851 16:84529937-84529959 TTGCAAATAACAAGACCTCCAGG - Intronic
1141554518 16:84828067-84828089 TTGCAGATCCCAAGGACTCCTGG + Intronic
1146505794 17:33403965-33403987 TTGCACTAAGCTAGAAATCCCGG - Intronic
1147767827 17:42848928-42848950 TTGCTCTTGCCCAGACCTCCTGG + Intronic
1148557465 17:48587089-48587111 TTGCCCTTGCTGAGAACTCCAGG + Intronic
1148725038 17:49783084-49783106 ATTCACTTACCAAGAAGACCAGG - Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1155513621 18:26601993-26602015 TTGCCCTTACCAGAACCTCCAGG + Intronic
1161861121 19:6798991-6799013 TTCCACTTACATAAAACTCCAGG - Intronic
1163241207 19:16064943-16064965 TTGCCTTTACAATGAACTCCAGG - Intergenic
1164917601 19:32064614-32064636 TTGCGCTTACCAAAAACTTTTGG - Intergenic
1165071741 19:33259778-33259800 CTCCACCTCCCAAGAACTCCAGG + Intergenic
1167683207 19:50938559-50938581 TTTCACATATCAAGAAATCCAGG - Intergenic
1167825342 19:51967871-51967893 TTGCAGTTACTAGGAACTCAGGG + Intronic
926095222 2:10077057-10077079 CTGCTCTGGCCAAGAACTCCTGG + Intronic
926551638 2:14308831-14308853 TTTCTCTTTCCAAGTACTCCTGG - Intergenic
926825444 2:16901507-16901529 TTGCATTTTCCAAGACCACCCGG + Intergenic
930140384 2:47945561-47945583 TTGCAGTTTCTAAGAACTCGTGG - Intergenic
931789046 2:65647078-65647100 CTGCATTTAACAAGAACTCCAGG + Intergenic
937745725 2:125411511-125411533 TGGCAATTCCCAAGAACTTCTGG + Intergenic
944296054 2:198063898-198063920 TTGCTCTTAACCAGTACTCCAGG - Intronic
944315875 2:198285343-198285365 TGACACTTGCCAACAACTCCTGG + Intronic
947697011 2:232199594-232199616 TTGCACTTAATAATAAATCCTGG - Intronic
947988818 2:234471227-234471249 TTGGACTTAGAAAGAACACCAGG + Intergenic
1169732647 20:8802782-8802804 TTGCTCTGACAAAGAGCTCCTGG - Intronic
1170444166 20:16407942-16407964 TTGCACTTAGCAAAAATCCCTGG + Intronic
1171996974 20:31739126-31739148 CTACACTTCCCAGGAACTCCGGG + Intergenic
1173990013 20:47294905-47294927 TTTCACTTAGCAAAGACTCCTGG + Intronic
1174379030 20:50144755-50144777 TTGCACTTACCTAGATGTCCTGG - Intronic
1178687788 21:34724773-34724795 CAGCACTGTCCAAGAACTCCAGG - Intergenic
1179718990 21:43304950-43304972 TTGCACTAATCACCAACTCCCGG - Intergenic
1180873990 22:19165912-19165934 TTGCACTGACTAAAACCTCCAGG - Intergenic
1181914558 22:26269212-26269234 GCACACTTACCAAGGACTCCAGG - Intronic
949923020 3:9018982-9019004 CTTCACTTAACAAGAAATCCTGG + Intronic
952759521 3:36901747-36901769 TAGTTCTTACCCAGAACTCCTGG - Intronic
953370116 3:42380427-42380449 TTGCATTTACCAAGTTCTCTTGG + Intergenic
954855241 3:53638590-53638612 TTGCACTTACCAACAAACCTGGG + Intronic
954999075 3:54910045-54910067 TTGCACTTACCAAGAACTCCTGG + Intronic
955950272 3:64236862-64236884 TTACACTTACTGAGCACTCCTGG - Intronic
957479307 3:80770804-80770826 TTGCATTTTCCAAGACCACCTGG - Intergenic
964192316 3:154017513-154017535 TTTCATTTATCAAGAACTGCTGG + Intergenic
964440726 3:156706354-156706376 TTTCAGTTACCAAGCTCTCCTGG + Exonic
968018942 3:195366571-195366593 CTGCATTTACCAAGATCTCCAGG + Intronic
971057390 4:22928939-22928961 TTGCAGTGACCAAGAAGTCAGGG - Intergenic
976085305 4:81401719-81401741 GTGCATTTACCAAGTTCTCCAGG - Intergenic
977698569 4:99994733-99994755 TGCCACTTACCAATAAGTCCTGG + Intergenic
977756895 4:100682512-100682534 TTGCATTTCCCAAGACCACCTGG + Intronic
978130411 4:105189280-105189302 TGGCATTTACCAAGAACCCCGGG + Intronic
978461760 4:108962678-108962700 TTCCACGTACCAAGAACTTCCGG - Intronic
982997111 4:162363373-162363395 ATTGACTAACCAAGAACTCCTGG - Intergenic
983492840 4:168409334-168409356 ATGATCTTACCAAGAACTCCAGG + Intronic
987421429 5:17725092-17725114 TTGGGCTTCCCAAGAACACCAGG + Intergenic
988226514 5:28418911-28418933 TTGAACTAATCATGAACTCCCGG - Intergenic
988401939 5:30774137-30774159 TTGTACTGGCCAAGAACTGCAGG + Intergenic
989144683 5:38236872-38236894 TCTCACTAACCTAGAACTCCTGG + Intergenic
989651822 5:43698735-43698757 TTGCACTTTCTAAGAACTTATGG + Intronic
991605058 5:68392770-68392792 TTGCCCTGACCTTGAACTCCAGG - Intergenic
993428763 5:87804117-87804139 TAGCACTTACCTAGGAATCCTGG - Intergenic
996330522 5:122323593-122323615 GTGGTCTTACCTAGAACTCCTGG + Intronic
1000666391 5:164003049-164003071 TAGCACTTTCCAAAAAGTCCTGG + Intergenic
1004524121 6:16390216-16390238 TTTTACTTCCCAAGAACTTCTGG + Intronic
1004779380 6:18891099-18891121 TTGCACTGACTAGGACCTCCAGG - Intergenic
1008727715 6:54441994-54442016 TTGCATTTCCCAAGACCACCTGG - Intergenic
1009874508 6:69488906-69488928 TAGCACATACAAAGAACCCCAGG - Intergenic
1019876159 7:3812831-3812853 TAGCACAGACCAAGAAGTCCTGG - Intronic
1032017864 7:128391371-128391393 ATTCACTTTGCAAGAACTCCTGG + Intergenic
1041873544 8:62661957-62661979 TTTCACCTACCAAGGTCTCCAGG + Intronic
1044236799 8:89840547-89840569 TTGCTGTAACCATGAACTCCTGG + Intergenic
1047776294 8:128073479-128073501 CTGCATTTACCAAGTACCCCTGG - Intergenic
1047911984 8:129540282-129540304 TTGCACCTAGCAGGAACTCAAGG - Intergenic
1048649928 8:136464201-136464223 TTGCACTTACAAAGATGACCTGG + Intergenic
1050064497 9:1744622-1744644 TTCCCATTGCCAAGAACTCCTGG - Intergenic
1050570179 9:6929728-6929750 TTGCACATACCAAGAAGTTGGGG - Intronic
1054798401 9:69324500-69324522 TTACACTTGCCATGCACTCCGGG + Intergenic
1054934205 9:70669360-70669382 TTGCAAAGACCAAGAACACCAGG - Intronic
1058399882 9:104603275-104603297 TTGCACCCACTAAGAATTCCAGG - Intergenic
1058400720 9:104615844-104615866 TTGCACCCACTAAGAATTCCTGG - Intergenic
1059707275 9:116837016-116837038 TTGCACTTAGAATAAACTCCAGG - Intronic
1188544260 X:31285964-31285986 CTGGACTTACCAAGAACAGCTGG + Intronic
1193532482 X:82673193-82673215 TTGGACATAACAAGAACCCCTGG + Intergenic
1194912316 X:99661524-99661546 TTGCATTTAACAAGATTTCCAGG + Intergenic
1195633972 X:107091793-107091815 TTGCACTTAACAATATGTCCTGG + Intronic
1196018432 X:110964345-110964367 TTGAATTTAGCAAGAACTCCTGG - Intronic
1198090737 X:133326626-133326648 TTGCAATCACCAACAACTCAGGG + Intronic