ID: 955000001

View in Genome Browser
Species Human (GRCh38)
Location 3:54918779-54918801
Sequence CTGGATCAGGAGCAGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 2, 1: 0, 2: 5, 3: 57, 4: 606}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954999994_955000001 2 Left 954999994 3:54918754-54918776 CCGGGCCACTGAGCCTGCGAGGA 0: 1
1: 0
2: 0
3: 21
4: 164
Right 955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG 0: 2
1: 0
2: 5
3: 57
4: 606
954999995_955000001 -3 Left 954999995 3:54918759-54918781 CCACTGAGCCTGCGAGGACACTG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG 0: 2
1: 0
2: 5
3: 57
4: 606
954999991_955000001 19 Left 954999991 3:54918737-54918759 CCACACCGTGGGCAGAGCCGGGC 0: 1
1: 0
2: 2
3: 14
4: 191
Right 955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG 0: 2
1: 0
2: 5
3: 57
4: 606
954999992_955000001 14 Left 954999992 3:54918742-54918764 CCGTGGGCAGAGCCGGGCCACTG 0: 1
1: 0
2: 2
3: 22
4: 250
Right 955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG 0: 2
1: 0
2: 5
3: 57
4: 606
954999988_955000001 27 Left 954999988 3:54918729-54918751 CCTCAGGACCACACCGTGGGCAG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG 0: 2
1: 0
2: 5
3: 57
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955000001 Original CRISPR CTGGATCAGGAGCAGGAAGA GGG Exonic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900373599 1:2343461-2343483 GAGGATCAGGAGCAAGATGAGGG - Intronic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
901059186 1:6464276-6464298 CTGGTTCAGGAATAGGAAGAGGG - Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
901468587 1:9439902-9439924 CAGGAACAGGAGCAGACAGAAGG - Intergenic
902359769 1:15936002-15936024 CAGGAGCAGGGGCAGGAAGGGGG - Exonic
902395495 1:16130339-16130361 CTGCATCATGAGCTGGTAGATGG + Exonic
902439687 1:16421434-16421456 GGGGATCAGGAGGAGGAAGAGGG - Intronic
902466124 1:16619876-16619898 CTGCAGCAGGAGCATGACGAGGG - Intergenic
902756703 1:18553616-18553638 CTGGAGCTGGGGCAGGAAGGGGG - Intergenic
903132537 1:21289508-21289530 CTGGAAAAGGGGCAGGGAGAGGG + Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192347 1:43906117-43906139 TGGGAAGAGGAGCAGGAAGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
907311241 1:53540313-53540335 CTGCTTCAGGAGGAAGAAGAGGG + Intronic
909833908 1:80230268-80230290 CTGGAGCAGGAGGAGAGAGAAGG + Intergenic
910112347 1:83696091-83696113 CTGGATCATGAGTAGAAACAAGG - Intergenic
910238733 1:85063317-85063339 GTGGACCAGGAGCAGCAGGAGGG + Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912506684 1:110161508-110161530 CAGGATCAGGAGCACGGGGAGGG + Intronic
912771430 1:112467233-112467255 CTAGATCAGGAGAAGTAAGCAGG + Intronic
913454721 1:119019296-119019318 ATGGATGGGGAGCTGGAAGAAGG - Intergenic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
913958552 1:143322952-143322974 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
914052869 1:144148332-144148354 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
914126328 1:144818209-144818231 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
915457213 1:156048744-156048766 CTGTATCAGGATCAGGACCAGGG + Intronic
915496100 1:156283720-156283742 CTGTTTCAGGAACAGAAAGAAGG - Intronic
916308514 1:163367549-163367571 CTGGAACAGCAGCAGGAACATGG - Intergenic
916715305 1:167442614-167442636 CTGGCCCAGGGGCAGGAAGGGGG - Intronic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
918794458 1:188874575-188874597 ATGGATGGGGAGCCGGAAGAGGG + Intergenic
919187206 1:194167664-194167686 CTTTATCAGGAGCATGAAAACGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920055727 1:203189942-203189964 CTGGATCAGGAGCCAGAGGGTGG + Intergenic
920199469 1:204250638-204250660 CTGCAGCAGGGGCAGGATGAGGG + Intronic
920338394 1:205259894-205259916 CTGGAGCAGGAAGAGGAATAGGG + Intronic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
922004125 1:221511561-221511583 CTTTTTCAGGACCAGGAAGATGG + Intergenic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
923791547 1:237115352-237115374 ATGGATCCGGAGAGGGAAGAGGG - Intronic
923863704 1:237917488-237917510 CTGGACCAGGAGCAGAAAAAGGG - Intergenic
924467425 1:244311205-244311227 GTGGAAGAGGAGGAGGAAGAGGG - Intergenic
924723465 1:246645052-246645074 GCAGATCAGGAGAAGGAAGAAGG - Intronic
1062824574 10:558308-558330 CTGGTTCAGGGTCAGGAAGCGGG - Intronic
1063273811 10:4541587-4541609 CAGGCTCAAGAGCAGCAAGAGGG - Intergenic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1064320400 10:14299304-14299326 CTGGTTCAGCAGCAAGAACATGG + Intronic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1066623900 10:37386041-37386063 CTGGGGCATGAGCAGGGAGAGGG - Intergenic
1067461542 10:46461970-46461992 CTGGAAGAGGAGCAGGAAGGTGG + Exonic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1067625652 10:47922631-47922653 CTGGAAGAGGAGCAGGAAGGTGG - Intergenic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068022196 10:51598946-51598968 CTGAAACAGGAAGAGGAAGAGGG + Intronic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1069910411 10:71755387-71755409 GTAGACCAGGAGCAGGATGAGGG + Exonic
1069995266 10:72338112-72338134 CTGGATCAGGATGGGAAAGAAGG + Intronic
1070153510 10:73819531-73819553 CTGGCTGAGGAGCAGAGAGAAGG + Exonic
1070379722 10:75869777-75869799 CTGGATCAAGAAGAGGCAGATGG - Intronic
1070409077 10:76122857-76122879 ATGGACCATGAGCAGGAAAATGG - Intronic
1070424682 10:76273779-76273801 CTGGATCAGGTGAATGAAAAGGG + Intronic
1070829287 10:79408799-79408821 CTGGGTCAGGGACAGGAAGGAGG - Intronic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070978880 10:80628508-80628530 CTTTATCAGGAGCATGAAAACGG + Intronic
1070987522 10:80701180-80701202 CTGGATCCTGAGCAGGGAGTAGG + Intergenic
1071333639 10:84584803-84584825 CTGGCTTGGGGGCAGGAAGATGG + Intergenic
1071529543 10:86378098-86378120 CAAGATCCGAAGCAGGAAGAGGG + Intergenic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072041578 10:91611592-91611614 CAGGAGCAGGACCAGGAACAGGG - Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073115879 10:101091376-101091398 CAGAATCAGGCCCAGGAAGATGG + Intronic
1073817738 10:107225724-107225746 CAGGTCCAGGAGCAGGAATAAGG + Intergenic
1074722332 10:116273471-116273493 CGGGAACAGGAGCAGGCCGAGGG - Intergenic
1074804070 10:117029678-117029700 CTGGAGCAGGAGCAAGAAGGTGG - Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076076384 10:127537178-127537200 CTGTCTCTGGAGCAGGAAGGAGG + Intergenic
1076740241 10:132479282-132479304 CTGGAGCAGGAGCTGGACAAGGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077134889 11:993611-993633 TGGGATCTGGAGCTGGAAGAGGG + Intronic
1077316721 11:1922614-1922636 CTGGAGCCAGGGCAGGAAGAGGG + Intronic
1077370760 11:2180559-2180581 CCTGAGCAGGAGCAGGAAGGAGG + Intergenic
1077581524 11:3420418-3420440 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1077968292 11:7159670-7159692 CTGGATCAGGAGCAGACACTTGG + Intergenic
1078023204 11:7672325-7672347 CAGGCTCAGGAGGAGCAAGAGGG + Intronic
1078069448 11:8098634-8098656 CTGGAACAGGAGCAGGCCCAGGG - Intronic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079810950 11:24999372-24999394 AAGGAGGAGGAGCAGGAAGATGG + Intronic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081083953 11:38775924-38775946 CTTGATCAGCAGCATGAAAATGG - Intergenic
1081312585 11:41592125-41592147 ATGGATGAGGAGCTGGAAGGGGG + Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081744194 11:45461650-45461672 CTGGGTCTGGAGCTGAAAGAGGG + Intergenic
1081874133 11:46397326-46397348 AGGGAACAGGAGGAGGAAGAGGG - Exonic
1083431071 11:62613666-62613688 CTGGATGAGGCGCTGGAGGAGGG + Exonic
1083894115 11:65611646-65611668 CTGGAGCAGGGACAGGAAGCCGG + Intronic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084238437 11:67803236-67803258 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1084833972 11:71789589-71789611 CTGGATGAGTCACAGGAAGAAGG - Intronic
1085016392 11:73176937-73176959 CTACAGGAGGAGCAGGAAGAGGG + Intergenic
1085022318 11:73217576-73217598 CTAGGACAGCAGCAGGAAGAAGG + Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085792856 11:79510935-79510957 AAGGACCAGGAGTAGGAAGAGGG - Intergenic
1085890361 11:80572464-80572486 CTTGATCAGCAGCATGAAAATGG - Intergenic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086246616 11:84760906-84760928 ATGGATGGGGAGCAGGAAGAGGG - Intronic
1087231559 11:95671781-95671803 CTGTATCAGAAGGAAGAAGAAGG + Intergenic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1088720041 11:112584341-112584363 TGGGATCAGGAGGAAGAAGATGG + Intergenic
1089048108 11:115521322-115521344 CTGGAGGAGGAGCCTGAAGATGG - Intergenic
1089255083 11:117189929-117189951 CTGTAGCAGGAGCAGGGACAGGG - Intronic
1089849722 11:121485712-121485734 GTGGTTTGGGAGCAGGAAGATGG + Intronic
1090358660 11:126157853-126157875 ATGGATCAGGTCCAGGAAGGTGG - Intergenic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1092144132 12:6202924-6202946 CTTCATCAGAGGCAGGAAGATGG + Intronic
1092252961 12:6911420-6911442 CTAGATCATTAACAGGAAGATGG - Intronic
1092409129 12:8240877-8240899 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1092652581 12:10650500-10650522 CTTGATCAGGAGCACAAAGTTGG - Intronic
1092766007 12:11853540-11853562 CTGCATCAGAACCATGAAGAAGG + Exonic
1092965135 12:13634096-13634118 CTGGAACATGAGTAGGAACATGG - Intronic
1093712194 12:22339975-22339997 ATGGATGGGGAGCTGGAAGAGGG - Intronic
1094056130 12:26271545-26271567 GAGGACCAGGAGGAGGAAGACGG + Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094472493 12:30816799-30816821 CTGGGAGGGGAGCAGGAAGAGGG + Intergenic
1095154722 12:38838621-38838643 CTTAATCATGAGCAGGAAGGTGG + Intronic
1095795159 12:46210870-46210892 CTTTATCAGGAGCATGAAAATGG + Intronic
1095903914 12:47357759-47357781 CTGGAGCAGTAGCACGATGAAGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1096504619 12:52084914-52084936 CTGGACCAGGGGTAAGAAGAGGG + Intergenic
1096575806 12:52552219-52552241 GCGGATCAGGAGCAGCAGGAAGG - Intronic
1096620588 12:52862234-52862256 CTGACTCAGGAGCTGGGAGAGGG - Intergenic
1096649250 12:53053824-53053846 CTGGAGCAGGAGGGGGAAGCAGG + Intronic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098585285 12:72146908-72146930 ATGGATGCGGAGCCGGAAGAAGG + Intronic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1099016194 12:77347074-77347096 CCAAATCAGGTGCAGGAAGATGG - Intergenic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1100340268 12:93672349-93672371 CTGGTTCAGGGGCTGGGAGATGG - Intergenic
1100558089 12:95717740-95717762 CTAGATAAGGAGCAGGAAAATGG + Intronic
1101759253 12:107645594-107645616 CTGGAGCATGAGCTGGAAGCTGG + Intronic
1102347890 12:112171175-112171197 CTCCACCAGGGGCAGGAAGAAGG + Exonic
1105743436 13:23353218-23353240 CTGTAACAGGGGCAGGAAAAGGG - Intronic
1105826195 13:24125680-24125702 GTTGCTCAGGAGCAGGAAGGAGG + Intronic
1106197825 13:27509314-27509336 AGGGATGAGGATCAGGAAGATGG - Intergenic
1106423446 13:29603163-29603185 CTGGAACAAAAGCAGGCAGAAGG - Intergenic
1108097862 13:46923714-46923736 CTTTATCAGGAGCATGAAAATGG + Intergenic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1110385575 13:74906832-74906854 ATGGATGAGGAGCTGGAAGCGGG + Intergenic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1111102860 13:83610691-83610713 CTTTATCAGTAGCATGAAGATGG - Intergenic
1111313102 13:86516298-86516320 CTTTATCAGTAGCAGGAAAATGG - Intergenic
1111500980 13:89119652-89119674 CTTGATCAGCAGCATGAAAACGG - Intergenic
1111518604 13:89367952-89367974 CTTTATCAGGAGCATGAAAATGG - Intergenic
1111929406 13:94498364-94498386 ATGAATCTGGAGCAGGGAGAGGG - Intergenic
1113198655 13:107839216-107839238 CTGGAATAGGAGCAGGAAGATGG - Intronic
1113879264 13:113614563-113614585 GTGGATCAGGGGAAGGTAGAGGG + Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1115507419 14:34105761-34105783 CTTCACCAGGAGCTGGAAGAAGG + Intronic
1116433983 14:44876540-44876562 CTGGATCAGGGACAGGACTAAGG + Intergenic
1116559010 14:46353101-46353123 TTGGATGAGGAGCTGGAAGCAGG - Intergenic
1117612168 14:57495326-57495348 ATGGATCTGGACCAGTAAGAGGG + Intergenic
1118302218 14:64625943-64625965 CTGGATCTGGAGCAGGAGGGAGG + Intergenic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119640820 14:76313566-76313588 CAGGCTCAGGTGCAGGAAGAGGG + Intronic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120692184 14:87605190-87605212 CTTTATCAGAAGCATGAAGATGG - Intergenic
1121152849 14:91653445-91653467 CTTGATCAGCAGCATGAAAAGGG - Intronic
1121519758 14:94577968-94577990 CTAGATCAGGAGCTAGAAGCTGG + Intronic
1121776211 14:96592764-96592786 CAGGAGCCGGAGCAGGAACAGGG - Intergenic
1122539085 14:102486878-102486900 ATAGACCAGAAGCAGGAAGAGGG + Intronic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1202929855 14_KI270725v1_random:27228-27250 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1123422448 15:20144005-20144027 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1123442557 15:20302337-20302359 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1123531676 15:21150545-21150567 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1123684287 15:22786532-22786554 GTGGGGGAGGAGCAGGAAGAGGG - Intronic
1124241142 15:28028534-28028556 CAGAAGCATGAGCAGGAAGAGGG + Intronic
1124449049 15:29768146-29768168 CTGGTTCAGGATCAGGATGAGGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125731965 15:41897557-41897579 CTGGAGCAGGAGGCGGAAGCAGG + Exonic
1125957508 15:43800498-43800520 CTAGAACTGGAGCAGAAAGAAGG + Exonic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127262654 15:57337389-57337411 GTGGCTCAGGAGCAGGGAGAGGG + Intergenic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129692544 15:77721927-77721949 CTGGCTCTGCAGCGGGAAGAGGG - Intronic
1130560214 15:84952117-84952139 CTAGAACAGGAGCTAGAAGAAGG + Intergenic
1130938530 15:88489600-88489622 CGGGATCAGGCGGAGGAAGAAGG - Intergenic
1131582700 15:93660757-93660779 CTGCAACATGTGCAGGAAGATGG + Intergenic
1131777172 15:95815236-95815258 TGGGACCTGGAGCAGGAAGAGGG - Intergenic
1131908147 15:97166296-97166318 CTTGACCAGGAGCAAGAACAAGG - Intergenic
1132024472 15:98393050-98393072 AGGGAACAGGAGCAGGAAGGGGG + Intergenic
1132141557 15:99401176-99401198 CTTGATCAGCAGCATGAAAATGG - Intergenic
1132547289 16:539220-539242 CTTAATCAGAAGCTGGAAGAAGG + Intronic
1132549438 16:548304-548326 GAGGCTCAGGAGCAGGAAGAGGG - Intronic
1133040023 16:3055842-3055864 CTGGAGCAGGAGCTGGCAGGCGG + Intronic
1133350094 16:5095686-5095708 CTGGATGAGTCACAGGAAGAAGG + Intronic
1134366243 16:13581889-13581911 ATGGATCAGGAGCTGGAAGATGG - Intergenic
1135465082 16:22677858-22677880 CTGCATCAGGGCCAGGAAGCTGG - Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135867897 16:26121548-26121570 TTGGATCAGTAGCAGGATGCAGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136718653 16:32303199-32303221 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1136837025 16:33509463-33509485 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1136862303 16:33711344-33711366 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1137760666 16:50937581-50937603 CTTCATCAGCAGCAGGAAAACGG + Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1139227643 16:65248567-65248589 CTGGATCAGGCCCATGAAAAGGG + Intergenic
1140234227 16:73144181-73144203 CGGGATCAGGACAAGGATGAGGG + Intronic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1142421029 16:89970203-89970225 CTGGAACAGGAGCTGGCAGTGGG - Exonic
1203007778 16_KI270728v1_random:214572-214594 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1203123796 16_KI270728v1_random:1559527-1559549 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1203147203 16_KI270728v1_random:1809742-1809764 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1143173442 17:4943336-4943358 CTGGATCTGGAGTTGGGAGATGG + Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1147609505 17:41793324-41793346 CCAGACCAGGAGCAGGAAGCGGG - Intergenic
1147660127 17:42112930-42112952 CTGGATCAGGAGCAGCCTGGAGG + Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148151922 17:45402160-45402182 CTGGCTCAGGGGCAGGGAAAGGG + Intronic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1149550120 17:57533681-57533703 CTTGATCAGGAGAGGGCAGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150294753 17:64001789-64001811 CTGTATCCAGAGCAGGAAGCTGG - Exonic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150775028 17:68074412-68074434 GTTGATCAGGAGCTGGAAGCGGG + Intergenic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151001920 17:70386705-70386727 CTGGAGCAAGAGCAGAAAGGAGG + Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1151250433 17:72829784-72829806 CTGCATCAGGAGCAGACAGGAGG - Intronic
1151367031 17:73624076-73624098 CTGGAGCAGGAGCAGGGAGGAGG + Intronic
1151509472 17:74549504-74549526 CAGGACCAGGAGCAGGACGTAGG + Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151819738 17:76491053-76491075 CTGGACCAGCTGCAGGATGAGGG - Intronic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152442465 17:80317404-80317426 CTGGATCAGAAACAGAAACACGG - Intronic
1152581589 17:81167742-81167764 CATGATCAGGGCCAGGAAGAAGG - Intergenic
1153939741 18:9967871-9967893 CTGGAGCAGGAACAGGATGCGGG - Intergenic
1154110875 18:11567484-11567506 CTGGAGGAGGTGGAGGAAGAGGG + Intergenic
1154313409 18:13284757-13284779 CTCGAGCAGGGGCAGGAAGGCGG - Intronic
1155155054 18:23150859-23150881 CTTGATCTGTTGCAGGAAGAAGG + Intronic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1155886145 18:31211121-31211143 GTGGGTCAGGAGCACTAAGAAGG - Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1157521952 18:48351600-48351622 ATGGATTAAGAGCAGGAAAACGG - Intronic
1157711222 18:49850953-49850975 CTGGATCGGGACCAGGACGCTGG + Intronic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1159586657 18:70288983-70289005 CTGGAGGAGGAGGAGGAAGGAGG + Exonic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160077749 18:75694156-75694178 GTGAATCAGGAGCCGGCAGAGGG - Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161723150 19:5914648-5914670 CTGGACCAGGCGGAGGCAGAGGG + Exonic
1162286981 19:9746130-9746152 CTGGATTAGGAACAGGAAAGAGG - Intergenic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163109418 19:15150405-15150427 CTGGTACAGGAGCAGCAAGGAGG + Intergenic
1163595714 19:18220070-18220092 CTGGATCAGAGGGAGGAACAAGG - Intronic
1163690908 19:18737766-18737788 CTGGCTGAGGAGGAGGAAAAGGG - Intronic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1164592297 19:29513507-29513529 GTGGATGAGGAGGAAGAAGAGGG + Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1167238500 19:48329409-48329431 CTGGAACATGAACAGGATGAAGG - Exonic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1202692265 1_KI270712v1_random:100756-100778 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925297089 2:2784489-2784511 ATGGGGCAGGAGCAGGCAGAAGG + Intergenic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
925680346 2:6414452-6414474 CTTGGGCAGGAGCATGAAGAGGG + Intergenic
925942673 2:8835853-8835875 CTTGAGCAAAAGCAGGAAGAAGG + Intronic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926234091 2:11026414-11026436 CTGCAGCAGGGGCAGGCAGATGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
929192265 2:39150469-39150491 CTGGAACTTGAGCAGGAAGTGGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929821984 2:45281319-45281341 CTGGAGCACGAGCAGAGAGAAGG - Intergenic
930491169 2:52074503-52074525 CTGCATTAGAAACAGGAAGAAGG + Intergenic
930503539 2:52254682-52254704 CTTTATCAGGAGCATGAAAACGG - Intergenic
930738180 2:54800896-54800918 CTGGAACAGGAGCTGGTAAATGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
932283890 2:70516899-70516921 CAGGATAGGGAGCAGGAACAGGG - Intronic
933260646 2:80127609-80127631 CTTCTTCAGGGGCAGGAAGAAGG - Intronic
933352910 2:81178359-81178381 ATGGATGGGGACCAGGAAGAAGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933954133 2:87353216-87353238 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
934238328 2:90249436-90249458 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
934274861 2:91567274-91567296 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
934460753 2:94212796-94212818 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
936284641 2:111172855-111172877 TCGGACCAGGAGCAGGAACAGGG + Intergenic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
936886032 2:117310735-117310757 ATGGATGGGGAGCAGGAAAAGGG + Intergenic
937726145 2:125168636-125168658 CTGGATCTGATGTAGGAAGAGGG + Intergenic
937868416 2:126770861-126770883 CTGGGTCAGGAGGAACAAGAGGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
939450457 2:142367069-142367091 ATGGATGAGAAGCTGGAAGAGGG + Intergenic
940018720 2:149134166-149134188 CTGGAGAAGGATCAGGCAGAGGG + Intronic
940340593 2:152576858-152576880 CTGGATCAGAATGAGTAAGAGGG + Intronic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
940638983 2:156329032-156329054 CTGGAGCCGGAGTTGGAAGAGGG - Intronic
941560176 2:167035141-167035163 CTTGATCAGCAGCATGAACATGG + Intronic
941640180 2:167978760-167978782 GCGGATCAGGAAGAGGAAGATGG - Intronic
941834752 2:170004260-170004282 CTGGAGCATGAGGGGGAAGAAGG + Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943051265 2:182916068-182916090 GAGGAGCAGGAGCAGGGAGACGG - Intronic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943454619 2:188089554-188089576 AGGGATCAGGATTAGGAAGAGGG + Intergenic
943521017 2:188949403-188949425 CGGGATGAGGAGCTGGAAGTGGG - Intergenic
943641211 2:190360182-190360204 TTCGATCAGCAGCTGGAAGAGGG - Exonic
943776635 2:191773508-191773530 CTTTATCAGGAGCATGAAAATGG + Intergenic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
945377558 2:209097012-209097034 ATGGATGGGGAGCCGGAAGAGGG - Intergenic
945570394 2:211459768-211459790 CTTTATCAGGAGCATGAAAATGG + Intronic
946142314 2:217702136-217702158 GGTGATCAGGACCAGGAAGACGG + Intronic
946211451 2:218150461-218150483 CAGCACCAGGAGCAGGAAGGTGG - Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947542305 2:230987457-230987479 CAGAATCAGGAGCAGGATCAGGG + Intergenic
947718390 2:232352939-232352961 CTGGATCAGGAGCTGGGGGAAGG - Intergenic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948373451 2:237505167-237505189 CTGCATCAGGACCAGCAAGGAGG - Intronic
948648640 2:239424962-239424984 CTGGACCAGGTCCAGGGAGAGGG + Intergenic
948806381 2:240455086-240455108 CAGGATCGGGAGGGGGAAGATGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169196762 20:3687373-3687395 ATGCATCTGGAGCAGGAATAAGG + Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169501254 20:6162939-6162961 ATAGATCAGGAGAATGAAGAAGG - Intergenic
1170146660 20:13182531-13182553 CTGGATCATGAGGAGGTTGAGGG - Intergenic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173153393 20:40587078-40587100 GTGGATCAGGAGCTGGAGGTCGG - Intergenic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1174656925 20:52179317-52179339 CTTCATCAGGAGCATGAAAACGG + Intronic
1175059933 20:56232758-56232780 TTGGACCTGGAACAGGAAGAGGG + Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175366426 20:58459514-58459536 AGGGATCAGGAGGAGGAAGGAGG + Exonic
1175991504 20:62792081-62792103 CTGGATGAGGCCCAGGGAGATGG + Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176591881 21:8655838-8655860 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1177339608 21:19782861-19782883 CTTTATCAGGAGCATGAAAAGGG - Intergenic
1177787080 21:25682786-25682808 ATGGATGGGGAGCTGGAAGAAGG + Intronic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1180274722 22:10632939-10632961 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1181643909 22:24220045-24220067 CTGGACCACGTTCAGGAAGAAGG + Exonic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181947256 22:26527988-26528010 CTGGATCAAGGACAGGGAGAGGG - Intronic
1182041452 22:27241821-27241843 CTGGGCCCTGAGCAGGAAGAGGG + Intergenic
1183315377 22:37134043-37134065 CTGTATCAGGAGCAGAAAACAGG - Intronic
1184067929 22:42130729-42130751 GTCCACCAGGAGCAGGAAGATGG + Exonic
1184070666 22:42144402-42144424 GTCCACCAGGAGCAGGAAGATGG + Intergenic
1184072549 22:42154939-42154961 GTCCACCAGGAGCAGGAAGATGG + Intergenic
1184255306 22:43283086-43283108 CTGGATGAGGAGCAGGGCCAGGG - Intronic
1184731701 22:46374221-46374243 CTGGCTCAGGAAAAGGAAGGGGG + Intronic
1184776361 22:46625480-46625502 CTGGGCCAGGAGCAAGGAGATGG - Intronic
1185178375 22:49344831-49344853 CTGGAACAGAAGCGGGAGGAGGG + Intergenic
949128284 3:471913-471935 CTGGAGCAGGAGCAAGAAGGAGG - Intergenic
949286409 3:2411169-2411191 CGGGGTCAGGGGCAGGATGAGGG + Intronic
949556424 3:5157378-5157400 CAGGCTCAGGACCAGGAAGTGGG - Intronic
949631457 3:5932155-5932177 CTAGACCAGGACCAGGAATAGGG - Intergenic
949708489 3:6846237-6846259 CAAGATCAGGAGAAGTAAGATGG + Intronic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
950678532 3:14569178-14569200 CTGAATCAGGGACAGGAAGGAGG - Intergenic
950887867 3:16376456-16376478 CTGAATCCTGGGCAGGAAGATGG - Intronic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
952881537 3:37989057-37989079 CTGGCTCCGGAGCAGGCAGGAGG + Intronic
953041453 3:39258163-39258185 CTGGCACAGCTGCAGGAAGATGG + Intergenic
953702896 3:45210392-45210414 CGGGAGCTGGACCAGGAAGATGG + Intergenic
954393389 3:50279284-50279306 CTGGAGCTGGAGCATGAAAATGG - Intronic
954619898 3:51989540-51989562 CTAGATGAGGGGCAGGCAGAGGG + Intergenic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
958899050 3:99863961-99863983 CTTAAGCAGGAGCAGGAAAAGGG + Intronic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959901415 3:111665860-111665882 CAGGAGCGGGGGCAGGAAGAAGG + Intergenic
960517313 3:118616579-118616601 TTTGATCAGTGGCAGGAAGAAGG - Intergenic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961300454 3:125918670-125918692 CTGGATGAGTCACAGGAAGAAGG - Intergenic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961576023 3:127837116-127837138 AAGGCTCAGCAGCAGGAAGAAGG + Intergenic
961888057 3:130109408-130109430 CTGGATGAGTCACAGGAAGAAGG + Intronic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
966967706 3:185011766-185011788 TAGGATCAGTAGGAGGAAGAAGG + Intronic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
968997200 4:3953345-3953367 CTGGATGAGTCACAGGAAGAAGG + Intergenic
969652313 4:8475034-8475056 CTGGAACAGGAACACGAAGGGGG - Intronic
969756813 4:9155329-9155351 CTGGATGAGTCACAGGAAGAAGG - Intergenic
969816781 4:9692906-9692928 CTGGATGAGTCACAGGAAGAAGG - Intergenic
971355160 4:25888636-25888658 AAGGATCAGGAGCTTGAAGAGGG - Intronic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
972591609 4:40493342-40493364 ATGGTTGAGGAGGAGGAAGAAGG + Intronic
975204167 4:71624957-71624979 CTTCATCAGCAGCAGGAAAATGG - Intergenic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
976335138 4:83876922-83876944 CTGGATTAGGCAGAGGAAGAAGG + Intergenic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
976847542 4:89507193-89507215 GGGGAACAGGAACAGGAAGAGGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977853942 4:101865033-101865055 CTTGATCAGGGGCAGGAAGAAGG + Intronic
978346932 4:107780664-107780686 GTGGATGGGGAGCAGGAAGCTGG + Intergenic
978542748 4:109836467-109836489 TAGGATCATGAGCAGGAAAAGGG + Intronic
978857757 4:113412598-113412620 CTGAATCAAGATCTGGAAGAGGG - Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
980136765 4:128865491-128865513 GTGGAACGGGTGCAGGAAGAAGG + Intronic
980137320 4:128871360-128871382 GAGGAGGAGGAGCAGGAAGAAGG - Exonic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
982474626 4:155834975-155834997 ATGGATCAGGAGCCAGAAGGGGG - Intronic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
982736841 4:159015861-159015883 ATGGATCAGGAGGTGGCAGAAGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983017956 4:162638755-162638777 CTTTATCAGGAGCATGAAAATGG + Intergenic
984347181 4:178543441-178543463 CTGGAGCATGAGCAGCAAAATGG + Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
985927097 5:3027143-3027165 CTGAATCCGGGGCAGGATGAAGG - Intergenic
986338786 5:6773429-6773451 CGGGAACAGGAGCGGGCAGATGG - Intergenic
986417917 5:7546917-7546939 CGGGCTCAGGAGAAGGAACATGG - Intronic
986692000 5:10320879-10320901 CTGGAGCAGGAGAAGAGAGAGGG + Intergenic
987510466 5:18829855-18829877 CTTTATCAGGAGCATGAAAATGG + Intergenic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
987772212 5:22319940-22319962 CGGGAGCAGGAGAAGGGAGATGG + Intronic
989078003 5:37585645-37585667 CTGGATCAAGAGCAGAATGATGG - Intronic
989366312 5:40659592-40659614 GTAGATCAGGAGCAAGAAGAAGG + Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991499396 5:67261824-67261846 TGGGCTCAGGAGGAGGAAGAAGG + Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
992210823 5:74478121-74478143 ATGGATGGGGAGCAGGAAGGAGG + Intergenic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993603117 5:89953332-89953354 CTGGATGGGGAGCATGAAGAAGG + Intergenic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
996463952 5:123778674-123778696 CAGGACCGGGAGCAGGCAGATGG + Intergenic
996537845 5:124596827-124596849 AGGGGTGAGGAGCAGGAAGAAGG + Intergenic
996886001 5:128354288-128354310 CTGACGCAGGAGCAGGAAGTAGG + Intronic
997157615 5:131576180-131576202 CTGGATTAGGAACAGGAAAGAGG - Intronic
997490812 5:134274351-134274373 CTTGATCAGCAGGAGGAAGTAGG - Intergenic
998211401 5:140201615-140201637 TTGAATCTGGAGCAAGAAGAAGG - Intronic
998228282 5:140343386-140343408 CTGGCTCAGGAACAGCAAGCAGG + Intronic
998334051 5:141355303-141355325 GTGTTTGAGGAGCAGGAAGAAGG + Exonic
999252955 5:150193406-150193428 TTGGCTCATGAGCAGGAAGAAGG - Intronic
999400723 5:151262267-151262289 CTGGATCAGGAACAGACTGAAGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999810964 5:155126790-155126812 ATGGATGGGGAGCTGGAAGAGGG + Intergenic
999820142 5:155219322-155219344 CTGGAACAGAAGCAAGATGATGG - Intergenic
1000816331 5:165927137-165927159 CTGGAGCTGGAGCAGGGTGAGGG - Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001825203 5:174739289-174739311 CAGGATCAGGAACAGCAGGATGG + Intergenic
1002053575 5:176585714-176585736 CTGGGTCAGGAGCAGGGAAGGGG + Intronic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002563325 5:180096914-180096936 CTGGTACAGGAGCAGGATGATGG + Intergenic
1002723719 5:181281618-181281640 CGGGAGCTGGAGCAGTAAGAGGG + Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003874337 6:10423012-10423034 CAGGGTCAGGGCCAGGAAGAAGG + Intergenic
1004469547 6:15917004-15917026 ATGGATCGGGAGCTGGAAGGGGG + Intergenic
1004919701 6:20364864-20364886 GTGGATCAAGAGCAGTGAGATGG - Intergenic
1005083437 6:21980492-21980514 GTGGTTCAGGAGCAGGGAGGAGG - Intergenic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083482 6:21980747-21980769 CTGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006814784 6:36842731-36842753 CTGCCCCAGGAACAGGAAGAAGG + Intergenic
1007278821 6:40695245-40695267 TTCCAACAGGAGCAGGAAGAAGG + Intergenic
1008104491 6:47427668-47427690 CTGGAGCAGGAGCAAGATGTGGG + Intergenic
1008976848 6:57437124-57437146 CAGGAGCAGGAGCAAGGAGAGGG + Intronic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1012042979 6:94234052-94234074 ATGGATGGGGAGCAGGAAGGGGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1012321101 6:97846983-97847005 GGGGATCAGGAGCAGGAAGTGGG + Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014429132 6:121345626-121345648 TATGATCAGGAGCAGTAAGAAGG - Intergenic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015273793 6:131363872-131363894 CTGGTTCAGGAACAGGCACATGG - Intergenic
1019398127 7:834373-834395 CTGGATCAGGACCAGAGGGAAGG + Intronic
1019547536 7:1585745-1585767 CTCCACCCGGAGCAGGAAGAGGG + Intergenic
1019728513 7:2616811-2616833 CTGGATGGGGAAGAGGAAGAGGG - Intergenic
1019860935 7:3657503-3657525 CTGGATTTAAAGCAGGAAGAGGG + Intronic
1020052878 7:5094075-5094097 CAGTATGAGGAGCAGAAAGAGGG + Intergenic
1020208573 7:6139843-6139865 CTGGTCCTGAAGCAGGAAGATGG - Intronic
1021123391 7:16822435-16822457 CTTGATAAGGATCAGCAAGATGG + Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021524637 7:21573761-21573783 ATGGGGCAGGAGCAGGAACATGG - Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023154283 7:37232517-37232539 ATGGACCTGGTGCAGGAAGATGG - Intronic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1024561677 7:50649975-50649997 CTGGGTCATGAGCAGAGAGATGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1026557781 7:71422888-71422910 ATGGATGGGGAGCAGGAAGGGGG + Intronic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1028367305 7:90048617-90048639 CTTGATCAGTAGCATGAAAATGG + Intergenic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1029109094 7:98203152-98203174 CTGGCTTCGGAGCAGGAAGGGGG - Intronic
1029450832 7:100641140-100641162 CTGGAGGAGGAAGAGGAAGACGG - Exonic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032454841 7:132065494-132065516 CTGGACCAGGAGCAGGCACAGGG - Intergenic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034524625 7:151649702-151649724 CGGGAGCAGGAGCAAGAAGGAGG - Intronic
1034557417 7:151858936-151858958 CTTGCAGAGGAGCAGGAAGAGGG - Intronic
1034881125 7:154763477-154763499 CTAGCTCAGGGGTAGGAAGAGGG - Intronic
1035320289 7:158024704-158024726 CTGCTTTAGGAGCAGGAAGGGGG + Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035827634 8:2661401-2661423 CTGGATTAGGAGGAGGACTAAGG + Intergenic
1036155390 8:6337459-6337481 CAGGAATAGGAGCAGGATGAAGG - Intergenic
1036380044 8:8230649-8230671 CTGGATGAGTCACAGGAAGAAGG - Intergenic
1036651841 8:10649227-10649249 GTGGATGAGGAGAATGAAGAAGG - Intronic
1036849515 8:12192013-12192035 CTGGATGAGTCACAGGAAGAAGG + Intronic
1036870877 8:12434286-12434308 CTGGATGAGTCACAGGAAGAAGG + Intronic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1038054905 8:23849078-23849100 CTGGACCAGGAGCCAGAACAAGG - Intronic
1038090231 8:24244811-24244833 CTTGATCAGCAGCATGAAAATGG + Intergenic
1038532421 8:28329137-28329159 ATGGTGCAGGAGCAGGAAGCAGG - Exonic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1039599036 8:38818290-38818312 CTGGATTAGGATTAGGAAGTAGG + Intronic
1039659489 8:39447330-39447352 ATGGATGAGGAGCTGGAAGAGGG - Intergenic
1039863421 8:41479356-41479378 CTGGACCAGGCAGAGGAAGAAGG - Intergenic
1039984279 8:42435080-42435102 CTTGATGAGGAGGAGGAAGTGGG + Intronic
1040767548 8:50931941-50931963 CTGGAGCAGGAGCAAGAAAATGG - Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1042051849 8:64718500-64718522 CTGGACCATGAGCACAAAGATGG - Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043342459 8:79256616-79256638 CTGACACAGGAGCAGGATGAAGG + Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045555194 8:103208759-103208781 CAGGATCAAGAGCAGGCAGCAGG - Intronic
1048977379 8:139680484-139680506 CTGGAGGAGGGACAGGAAGATGG + Intronic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049238191 8:141523201-141523223 CTGGAGCAGGGGCAAGGAGAGGG - Intergenic
1049356294 8:142190187-142190209 CCCCATCAGGAGCAGGAAGTCGG - Intergenic
1049422348 8:142522618-142522640 CTGGAGAAGGAGCAGAGAGAGGG - Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1051342767 9:16127148-16127170 CTGGAAGAAGAGCATGAAGAGGG - Intergenic
1051983801 9:23057637-23057659 ATGGATGAGGAGCAGGAAAGAGG - Intergenic
1052885915 9:33647912-33647934 TTGGATGGGGAGCTGGAAGAGGG - Intergenic
1053691251 9:40588494-40588516 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1054273550 9:63048991-63049013 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1054302511 9:63389465-63389487 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1054401284 9:64715965-64715987 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1054434892 9:65200285-65200307 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1054495497 9:65821396-65821418 CTGGGTCAGGGCCAGGAACAAGG + Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1055679276 9:78698209-78698231 CTGATTCAGGAGCAGGGAAAGGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055995057 9:82148322-82148344 GTGGATTGGCAGCAGGAAGAAGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056638475 9:88350327-88350349 AGGGACCTGGAGCAGGAAGATGG - Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057068469 9:92075922-92075944 CTGGGTCAGGGACAGGAAAAAGG - Intronic
1057164874 9:92917549-92917571 TTGGAGCTGGAGCAGGAACAAGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058644239 9:107115916-107115938 CTGGATTAGAAACTGGAAGATGG + Intergenic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058896132 9:109402045-109402067 CTGGATCAGGAACCTGATGAGGG - Intronic
1058908910 9:109503248-109503270 CTGGCTCAGGAGCGAGAAGGTGG + Intergenic
1059640220 9:116209519-116209541 CTGGCTCAGGGCCAGGAATAAGG + Intronic
1060277164 9:122191049-122191071 CTGGACCAGGACCTGGAGGAAGG - Intronic
1062097767 9:134711776-134711798 TTGGATCAGGAGATGCAAGAAGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062543781 9:137052999-137053021 CTGGGGCAGGAGCTGGAAAAGGG - Intronic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1203621921 Un_KI270749v1:134657-134679 CTGGGTCAGGGCCAGGAACAAGG - Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1187112335 X:16314526-16314548 CTGGTTCCCGAGCAAGAAGAGGG + Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1187332296 X:18352024-18352046 AGGGAACAGGGGCAGGAAGAGGG + Intronic
1187502654 X:19852549-19852571 CAGGAACAGGGGCAAGAAGACGG - Intronic
1188307509 X:28576219-28576241 CTGGCTCAAGTGGAGGAAGACGG + Intergenic
1188923967 X:36016281-36016303 GTGGATGAGGGGCAGGATGAGGG - Intergenic
1191882835 X:65859736-65859758 TTGACTCAGGAGCAGTAAGAGGG - Intergenic
1192764212 X:74125878-74125900 CTGGATTAGGAACAGGAAAGAGG + Intergenic
1193849313 X:86516706-86516728 CTTGAGAAGGGGCAGGAAGAGGG - Intronic
1194148597 X:90294873-90294895 CGTGAGCAGAAGCAGGAAGATGG + Intergenic
1195229276 X:102829808-102829830 CTGGAAGGAGAGCAGGAAGATGG + Intergenic
1195260200 X:103124406-103124428 CTGGAAGTGGAGTAGGAAGATGG - Intergenic
1195273281 X:103254212-103254234 CAGGAGCAGGAGGAGAAAGATGG - Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196764621 X:119231713-119231735 GAGGATGAGGAGTAGGAAGAAGG + Intergenic
1196917799 X:120556762-120556784 CTGGATTAGGAGTCAGAAGATGG - Intronic
1198214912 X:134546544-134546566 CCGGCTCAGGAGCAGGTAGGTGG - Intergenic
1198919201 X:141707281-141707303 CTTTATCAGCAGCATGAAGATGG - Intergenic
1200127300 X:153821887-153821909 CTGGCTCAGAAGCAGAAAGGAGG + Intronic
1200835585 Y:7728175-7728197 CTGAATCTTGAGCAAGAAGATGG - Intergenic