ID: 955000423

View in Genome Browser
Species Human (GRCh38)
Location 3:54922385-54922407
Sequence GTGGATTAAATTGTAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955000423 Original CRISPR GTGGATTAAATTGTAAGCAC AGG (reversed) Intronic
901261686 1:7876036-7876058 GGGGATCAAATGGTATGCACAGG - Intergenic
902162812 1:14545366-14545388 GTGGTTTTAATTGCAAGCTCTGG + Intergenic
906229575 1:44150003-44150025 GTGCAGTAAGTTGTAAGCATTGG - Intergenic
910192568 1:84609097-84609119 AAGGATTAAAATGCAAGCACAGG + Intergenic
911096580 1:94060146-94060168 GTAGTTAAAATTGTAAGCCCAGG + Intronic
912968466 1:114258129-114258151 TTGGACTAAAATGGAAGCACTGG - Intergenic
913071867 1:115306650-115306672 GTGGTTTTCATTGCAAGCACTGG + Intronic
915347079 1:155202988-155203010 GTGGCTTAAATAGTGACCACCGG - Intronic
916337169 1:163685951-163685973 GTGCATTGAAGTGTAAGCAAAGG + Intergenic
916840802 1:168598491-168598513 GGGGATAAATTTGTAAGTACTGG - Intergenic
916846054 1:168651336-168651358 GTGATTAAAAATGTAAGCACTGG - Intergenic
920728355 1:208459111-208459133 GTGAATTAAACTTTAAGCCCTGG - Intergenic
921235418 1:213122309-213122331 GTTGATTATATTTAAAGCACTGG + Intronic
921712069 1:218382884-218382906 GAGTATTCAATTTTAAGCACTGG + Intronic
922063349 1:222112471-222112493 GGGGATTAAATTTTCAGCACAGG - Intergenic
923816232 1:237382126-237382148 GTGGATTGGATTGTTTGCACTGG + Intronic
1066479718 10:35783936-35783958 GTTGTATAAATTGTCAGCACTGG - Intergenic
1068417444 10:56742410-56742432 GTGAAATCAATTGTAAGCTCTGG - Intergenic
1072906727 10:99460951-99460973 GTGATTTAAATTGTAAGTAACGG - Intergenic
1074269782 10:111942499-111942521 TTGGATTAAATTGAAGGCAATGG - Intergenic
1076042135 10:127259295-127259317 GTGGACTTAATAGAAAGCACTGG + Intronic
1079643821 11:22838369-22838391 GTGCATAAGATTGTAAGGACCGG + Intergenic
1081111851 11:39145560-39145582 GGGGATTACATTGTACACACAGG - Intergenic
1088429846 11:109747075-109747097 CTGAATTAAGTTGTAACCACAGG - Intergenic
1092337997 12:7651043-7651065 GTGGATGATGTTGTACGCACTGG - Exonic
1106362579 13:29046028-29046050 GTAGAGTCATTTGTAAGCACGGG - Intronic
1106392771 13:29351515-29351537 GTAGAGTTATTTGTAAGCACGGG - Intronic
1106932499 13:34682099-34682121 GTGGATTATATTGTAAATTCAGG + Intergenic
1108029003 13:46208576-46208598 CTGCATTAAATTTCAAGCACAGG - Intronic
1108313722 13:49219042-49219064 GAGGATTAAATGGAGAGCACAGG + Intergenic
1108938153 13:55912346-55912368 GTGACTCAAATTGTAAGCAAGGG + Intergenic
1109713839 13:66194510-66194532 GTGGAATAAATTGGAAGAAGAGG + Intergenic
1109782941 13:67136566-67136588 CTGTATTAAATTGTACTCACTGG + Intronic
1109896112 13:68693211-68693233 CAGGATTACATTGTAAGTACAGG - Intergenic
1110443502 13:75550395-75550417 GTGGATGAAATTACAAGGACTGG - Intronic
1111705759 13:91747508-91747530 GTGGGGTAAATTCTAATCACTGG - Intronic
1115921594 14:38380287-38380309 GGGGATTACATGGTAAGAACAGG + Intergenic
1119665453 14:76482089-76482111 GTGGAGAAATTTGTAAGCTCAGG - Exonic
1122005027 14:98696147-98696169 GTGGATAATAATGTAAACACAGG + Intergenic
1123693576 15:22859986-22860008 GTTGAGTAAATTTTAAGCACTGG + Intronic
1123886124 15:24729690-24729712 GTAGCTTCTATTGTAAGCACGGG - Intergenic
1126279036 15:46921461-46921483 GTGCATTAAAATGTCAGCAATGG - Intergenic
1129558012 15:76534107-76534129 GCAGATTAAAATGTAAACACTGG + Intronic
1131458424 15:92601482-92601504 GTGTTTTAAAATGTAAGCTCTGG - Intergenic
1133782359 16:8949503-8949525 GTGGATGAAAATAGAAGCACAGG - Intronic
1135575881 16:23585269-23585291 GTGGATTAAACTGAAAGAAGTGG - Intronic
1143448245 17:7021242-7021264 GTTGATTTGATTGTGAGCACCGG - Intergenic
1144000729 17:11052344-11052366 GTGAAGTAAAGTGTGAGCACAGG + Intergenic
1149070446 17:52536112-52536134 GTGCATTAAACTCTAATCACAGG - Intergenic
1157808738 18:50678242-50678264 ATGGATTAATTAGGAAGCACTGG + Intronic
926649949 2:15332466-15332488 GTTGGGTAAATTGTAAGCATTGG - Intronic
926909764 2:17841324-17841346 CTGAATTAAATTGTAAGGGCAGG - Intergenic
927164993 2:20309495-20309517 CTGGACTAAATTTTAAGCACTGG + Intronic
930551275 2:52837654-52837676 ATGGATTAACTTGTATGCAGTGG + Intergenic
930679982 2:54247004-54247026 GAGTATTAAATTCCAAGCACAGG + Intronic
931633809 2:64324189-64324211 ATGGATTGATTTGAAAGCACTGG + Intergenic
934888318 2:98044430-98044452 GTGGTTTTAAATGTAAGCAGGGG + Intergenic
939937122 2:148306233-148306255 CTGTATTCAATTGTAAGAACGGG + Intronic
940493015 2:154389500-154389522 GTGCATGAAATTGTAAGCTTTGG + Intronic
942424130 2:175841483-175841505 AGGGATTAAACTGTAAGAACTGG - Intergenic
1170431072 20:16277540-16277562 GTGGAAAACATTGTGAGCACAGG - Intronic
1172434108 20:34916228-34916250 GTGGCTTAAATTGTAATCTCTGG + Intronic
1176516410 21:7787449-7787471 ATGGATTCAATTGATAGCACAGG + Intergenic
1178650438 21:34417461-34417483 ATGGATTCAATTGATAGCACAGG + Intergenic
1180168719 21:46046140-46046162 GTAGATAATATTGAAAGCACTGG + Intergenic
951087369 3:18529260-18529282 ATGGATTAAACTGTATGCAAAGG - Intergenic
954496541 3:50969411-50969433 GTGGAATAAATTTTAAAAACAGG - Intronic
955000423 3:54922385-54922407 GTGGATTAAATTGTAAGCACAGG - Intronic
955779891 3:62473155-62473177 GGGGATTAAGTTCTAAGCACTGG - Intronic
959576570 3:107940696-107940718 ATGGATTACATTGCAGGCACTGG + Intergenic
960595693 3:119406030-119406052 ATGGATTCAATTGGAATCACTGG + Intronic
960768339 3:121163571-121163593 GTTTATTAAATTTTAAGCTCTGG - Intronic
961428820 3:126865456-126865478 GTTGATGAAAGTGTAGGCACTGG - Intronic
962453160 3:135538795-135538817 GGGGCTTAAATTGTAAGCTGTGG - Intergenic
965783816 3:172315699-172315721 GTAGATTAAAGTGTAAACACGGG - Intronic
966695104 3:182781469-182781491 GTGGATTAAATTGTATACAGTGG + Intergenic
967803895 3:193696140-193696162 ATGCATTAACCTGTAAGCACTGG - Exonic
974088566 4:57286936-57286958 GAGAATTGAATTGTAAGCAGAGG - Intergenic
974097706 4:57382977-57382999 GTAGATTAAAATATCAGCACTGG - Intergenic
975161606 4:71130980-71131002 GGGGATTACATTCTCAGCACGGG - Intergenic
976306206 4:83562091-83562113 GTAGAAGAAATTGTAAGCAAAGG + Intronic
976496451 4:85735453-85735475 GAGGATTAAAATGTAATCAATGG - Intronic
977445006 4:97120451-97120473 GTGAATTACATTGTAAACATGGG - Intergenic
979188312 4:117826507-117826529 GTTGATAAAAATGTGAGCACAGG - Intergenic
979755118 4:124330842-124330864 GTGGTTTAAAGTGTAGTCACTGG + Intergenic
979952689 4:126913987-126914009 TTGGGTAAAATTCTAAGCACAGG + Intergenic
982146378 4:152398864-152398886 ATTGATAAAATTGTAACCACTGG + Intronic
982371854 4:154642354-154642376 GTGGTTTAAAGTGTAGGCTCTGG - Intronic
982542995 4:156698228-156698250 GTGGAAAACATGGTAAGCACTGG - Intergenic
982572480 4:157067644-157067666 GTGGATAAGATTCAAAGCACAGG + Intergenic
984035786 4:174665830-174665852 GTGTATTGACTTGTAATCACTGG + Intronic
987715913 5:21570736-21570758 GTAGATTAGATTCTAAACACAGG + Intergenic
988211599 5:28211666-28211688 ATGGATTAAATTGAGAGCCCAGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
995054957 5:107748648-107748670 ATTGATGAAATTGTAATCACTGG - Intergenic
995160123 5:108969547-108969569 GTGGTTGAAATTGAAAGCAGAGG + Intronic
1002530771 5:179843385-179843407 ATGGACTGAATTGGAAGCACAGG + Intronic
1004286022 6:14321839-14321861 GTGGTTTGAAATGTGAGCACTGG - Intergenic
1007814558 6:44511846-44511868 GTGGGTTAATTTTTAAGGACAGG + Intergenic
1008579682 6:52895609-52895631 GTAGATTTAATTGTGATCACTGG + Intronic
1008759988 6:54842893-54842915 ATCAATTAAATTGTAAGTACTGG + Intergenic
1009000805 6:57711324-57711346 GTAGATTAGATTCTAAACACAGG - Intergenic
1009752282 6:67888322-67888344 ATGGATTACATTGGAAGCATAGG + Intergenic
1012165448 6:95945174-95945196 GTGAAAAAAAATGTAAGCACTGG + Intergenic
1015435451 6:133181478-133181500 GTGGATGAAATATTAAGAACTGG - Intergenic
1016635282 6:146282091-146282113 GTGGATAATACTGTCAGCACTGG + Intronic
1024468499 7:49740327-49740349 GTTGAGTAAAATGTAACCACTGG + Intergenic
1027748004 7:82102714-82102736 GTGGATTTAATTGCCAGCACAGG - Intronic
1029122980 7:98281082-98281104 GGGGAGTTATTTGTAAGCACTGG + Intronic
1037115816 8:15225615-15225637 GTGGATTATAACGTAAGCAATGG + Intronic
1037353233 8:17987378-17987400 TTGGATAAAAGTGAAAGCACTGG - Intronic
1042363225 8:67906467-67906489 TGGGATTTTATTGTAAGCACTGG + Intergenic
1043063311 8:75532498-75532520 GTGGTATAAAAAGTAAGCACTGG - Intronic
1046319064 8:112546673-112546695 GCAGATTAAAATGTAAGCAGAGG + Intronic
1046785193 8:118258304-118258326 GTGGTTTATAATGAAAGCACAGG - Intronic
1052578668 9:30324488-30324510 GTGGATTTAATTGTAATCAAAGG - Intergenic
1052605605 9:30695382-30695404 TTGGATTAAATTGGATGCAATGG - Intergenic
1055560904 9:77520688-77520710 GTCTTTTAAATTGCAAGCACAGG - Intronic
1057769353 9:97953624-97953646 GTGGATTGACTTGTAAACAAAGG - Intergenic
1058214059 9:102210961-102210983 GTCTATTAAAATGTAAACACTGG + Intergenic
1058963687 9:110016610-110016632 ATGCATCAATTTGTAAGCACTGG + Intronic
1059204152 9:112447750-112447772 GTGGATAAAATTGCAGGCTCTGG + Intronic
1188266146 X:28077650-28077672 GTGGGTGAAATTGTACACACAGG + Intergenic
1198766608 X:140086351-140086373 ATGGATTAAATGGAAAGCCCTGG + Intergenic