ID: 955001379

View in Genome Browser
Species Human (GRCh38)
Location 3:54930728-54930750
Sequence CTACCTCGCCGGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955001372_955001379 26 Left 955001372 3:54930679-54930701 CCCAGGCTCTCTGAGCATCAGCA 0: 1
1: 0
2: 6
3: 40
4: 338
Right 955001379 3:54930728-54930750 CTACCTCGCCGGAGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 92
955001373_955001379 25 Left 955001373 3:54930680-54930702 CCAGGCTCTCTGAGCATCAGCAT 0: 1
1: 1
2: 3
3: 29
4: 299
Right 955001379 3:54930728-54930750 CTACCTCGCCGGAGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955001379 Original CRISPR CTACCTCGCCGGAGGCAGGG AGG Intronic
901155395 1:7134047-7134069 CTACCTGGGGGGAGTCAGGGAGG - Intronic
901434268 1:9236582-9236604 CTCCGTCACCGGAGGCAGGGCGG - Intronic
902331784 1:15734460-15734482 CTGCCTCGCCAGATGCAGGGGGG + Exonic
902833969 1:19035001-19035023 CTCCCTGGCAGGAGGCAGGGTGG - Intergenic
903370451 1:22831891-22831913 CTACCTAGCCAGAGGCAGCCAGG + Intronic
904267639 1:29326721-29326743 CTACCTCGCAGGGGGCTGTGGGG + Intronic
915340130 1:155172929-155172951 GTAGCTTGCCGGAGGGAGGGCGG - Intronic
915570645 1:156743543-156743565 CAGCCTCTCGGGAGGCAGGGTGG - Intronic
917291736 1:173477730-173477752 CAGCCACGCCGGAGGCGGGGAGG - Intronic
1063115188 10:3067715-3067737 CTCCCTCGCCGCCGGGAGGGGGG - Intronic
1065974849 10:30833403-30833425 CTCCGTAGCAGGAGGCAGGGTGG + Intronic
1069676715 10:70253995-70254017 CTCCCTCCCAGGAAGCAGGGAGG + Exonic
1070587063 10:77774468-77774490 CAAGCTCCCCGGAGACAGGGTGG - Intergenic
1071826163 10:89328299-89328321 CTACATGGGGGGAGGCAGGGTGG + Intronic
1072390986 10:94986800-94986822 CTACCTCAAAGGAGGCAGAGAGG + Intronic
1072427965 10:95346060-95346082 CTACATAGGAGGAGGCAGGGTGG + Intronic
1075782437 10:125026173-125026195 CTGGCTGGCCGGCGGCAGGGTGG + Exonic
1077286067 11:1766556-1766578 CTACCTCGCAGGGAGCTGGGAGG - Intergenic
1078430121 11:11281898-11281920 CTCCCTCCCTGGAGGCTGGGAGG + Intronic
1082720656 11:56671456-56671478 CTACTTCATCGGAGGCAGGAGGG + Intergenic
1084870938 11:72098199-72098221 CTACCTCCTCTGAGGCAGAGTGG + Intronic
1086244050 11:84729855-84729877 CTACCTAGGAGGTGGCAGGGAGG - Intronic
1088762511 11:112945768-112945790 CTACCTTTAAGGAGGCAGGGAGG - Intergenic
1089698264 11:120228921-120228943 CTGCCTCGCTGCAGGCAGGTGGG + Exonic
1091582205 12:1796860-1796882 CTGCCTCCCCGGGGCCAGGGCGG + Intronic
1095096204 12:38150725-38150747 ATGCCTCCCAGGAGGCAGGGAGG - Intergenic
1098893337 12:76031458-76031480 CTAACACGCAGGAGGCAGAGCGG + Exonic
1103928103 12:124434738-124434760 CTTCCTCGCAGGAGACAGAGGGG + Intronic
1104908529 12:132228381-132228403 CTGCCTCGCCAGAGGCAAAGAGG - Intronic
1112494537 13:99894721-99894743 ATACCTTGCCTGAGGCGGGGGGG + Exonic
1118458523 14:65966795-65966817 CTACCTCTCCAGCCGCAGGGAGG - Intronic
1123086850 14:105720804-105720826 TAGCCTCGCTGGAGGCAGGGTGG + Intergenic
1126736564 15:51737291-51737313 CTACCGCGCAGGAGGCGGTGCGG - Intronic
1127811370 15:62568241-62568263 CTACCTCGCCCAGGGCAGGGAGG - Intronic
1127820939 15:62655542-62655564 CTGCCTCTCCGGTGGCAGGGTGG - Intronic
1131432021 15:92394949-92394971 CGACCTCGCCAGAGGTAGGGTGG + Intronic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1134194366 16:12147685-12147707 CTGCCTCTCCGGAGGCAAAGAGG - Intronic
1134784231 16:16926271-16926293 CTGCCCCGGCGGGGGCAGGGGGG - Intergenic
1142195639 16:88738131-88738153 CTACCACCCCAGAGGCAGTGGGG + Intronic
1145206496 17:20987156-20987178 CTACTTGGGGGGAGGCAGGGAGG + Intergenic
1148731034 17:49836812-49836834 GCACCTCGCCGGTGGCTGGGTGG + Intergenic
1152655575 17:81517785-81517807 CTTCCTCCCCAGAGGCAGCGAGG + Intronic
1156556936 18:38078400-38078422 ATACCTCTCTGGAGGGAGGGAGG + Intergenic
1159976007 18:74712596-74712618 CTGTCTCCCTGGAGGCAGGGAGG + Intronic
1164809003 19:31141411-31141433 CAACCTGGGCGGAGGCTGGGAGG - Intergenic
1165902968 19:39177412-39177434 CTACCTGGGCTGAGGGAGGGAGG + Intronic
1166947094 19:46404088-46404110 CTACCCCGCAGGGGGCAGGTGGG + Intergenic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
1168100480 19:54138487-54138509 CTCCCTCGACGGTGGCGGGGAGG + Intronic
933707692 2:85304111-85304133 CTGCCTGGGCGGGGGCAGGGAGG - Intronic
937310035 2:120896381-120896403 CTTCCCTGCCTGAGGCAGGGTGG + Intronic
946271060 2:218594593-218594615 CTACCTAGCCACTGGCAGGGAGG + Exonic
947934130 2:233988715-233988737 CCACCTAGCTGGTGGCAGGGAGG + Intronic
1169732568 20:8802155-8802177 CTACCTGGCCGGAAGGACGGTGG - Intronic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1171484881 20:25479407-25479429 CTATCCCCCCTGAGGCAGGGCGG + Intronic
1171796472 20:29570318-29570340 CTACGTGGGCGGAGGCTGGGAGG + Intergenic
1172193735 20:33077935-33077957 CTTCCTCCCTGGAGGCAGTGGGG - Intergenic
1180736929 22:18024323-18024345 CTGCCTCGGCAGGGGCAGGGTGG + Exonic
1182149954 22:28020933-28020955 CTGCCTCGCAGAAGGCAGGGCGG - Intronic
1182624783 22:31637989-31638011 CTCCCACGCCAAAGGCAGGGCGG - Intronic
1184118128 22:42433723-42433745 CTACCGCGCAGGGGGCAGGCGGG + Intergenic
950225966 3:11234748-11234770 CTCCCTCTCCTCAGGCAGGGCGG + Intronic
954611499 3:51946872-51946894 ATGCCTAGCCGGGGGCAGGGTGG + Intronic
955001379 3:54930728-54930750 CTACCTCGCCGGAGGCAGGGAGG + Intronic
962899022 3:139740981-139741003 CAACCTCGCTGGAGACAGGTGGG + Intergenic
965497330 3:169414073-169414095 CTCCCTCTCAGGAGGCACGGGGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
968983881 4:3865147-3865169 CTACCTGGGCCCAGGCAGGGAGG - Intergenic
969213856 4:5708210-5708232 CTACACCGGCGGTGGCAGGGAGG - Intronic
969420675 4:7093265-7093287 CTACCTCGTTGGGGGAAGGGGGG + Intergenic
969980579 4:11150113-11150135 CTATCTTGCCTAAGGCAGGGAGG - Intergenic
972973522 4:44606029-44606051 CTACCTCTCTGAAGGCAGAGAGG + Intergenic
973773335 4:54225822-54225844 CTTCCTCGCTGGACCCAGGGAGG + Intronic
975120143 4:70719295-70719317 CTACCTGGAGAGAGGCAGGGTGG + Intronic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
990649922 5:57886916-57886938 CTGTCTCGCAGGGGGCAGGGGGG - Intergenic
1000757920 5:165184206-165184228 CTACCTCTGCGGAGTCAGGCAGG + Intergenic
1005982648 6:30848221-30848243 CAACCTCGACGGAGGGTGGGAGG - Intergenic
1008157526 6:48034890-48034912 CTACCTCGTCAGGGACAGGGTGG + Intronic
1008555218 6:52666907-52666929 CTACCTCTCCAGAGGCAGGAGGG - Intergenic
1011734315 6:90296544-90296566 CCACCTCGCCGGCTGCCGGGAGG - Exonic
1013917141 6:115354433-115354455 CTACCTGGCCGGGAGCAGTGAGG + Intergenic
1013986965 6:116206059-116206081 CTACTGAGCAGGAGGCAGGGTGG - Intronic
1019373593 7:676820-676842 CTACCTCCCCGAGGGCAAGGAGG + Intronic
1019436707 7:1025921-1025943 CCACCTGGCCGGAGGCAGAAGGG - Intronic
1019577842 7:1746093-1746115 CCACCTCGCCGGCCGCAGGCAGG - Exonic
1019629153 7:2037421-2037443 GTGCCTCGCCGAAGGCAGGACGG - Intronic
1031792209 7:126120084-126120106 TTACGTTGCAGGAGGCAGGGTGG - Intergenic
1034222875 7:149459808-149459830 CTACCCCGACGGACGCAGCGCGG + Intronic
1034345882 7:150384851-150384873 ATACCTCTTGGGAGGCAGGGTGG + Intronic
1036637900 8:10564261-10564283 CTGCCTCTCCGGAGGAAGGGAGG + Intergenic
1036682455 8:10885523-10885545 CCACCACGCCAAAGGCAGGGTGG + Intergenic
1041966591 8:63685581-63685603 CTTCGTGGCCAGAGGCAGGGTGG + Intergenic
1048980551 8:139701702-139701724 CTGCATGGCAGGAGGCAGGGTGG - Intronic
1050107280 9:2178572-2178594 CTTTCTGGCCGGGGGCAGGGTGG + Intronic
1057719807 9:97522973-97522995 CTAGCTCAGCGGAGGCAGTGTGG + Intronic
1057818632 9:98314599-98314621 CTACCTCACCGGGAGCAGGAGGG - Intronic
1062089835 9:134669716-134669738 CTACCACGCCGGAGGAAGTGGGG + Intronic
1190441638 X:50480710-50480732 CTACTTAGCAGGAGGTAGGGAGG - Intergenic
1195743699 X:108092066-108092088 CTCCCTAGGCGGTGGCAGGGAGG - Intronic