ID: 955004965

View in Genome Browser
Species Human (GRCh38)
Location 3:54959874-54959896
Sequence AGGTTTCTTCAGATGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955004960_955004965 6 Left 955004960 3:54959845-54959867 CCGGCAGCCTGGGAAAGCTGAGG 0: 1
1: 1
2: 0
3: 72
4: 708
Right 955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 204
955004963_955004965 -1 Left 955004963 3:54959852-54959874 CCTGGGAAAGCTGAGGGAATATA 0: 1
1: 0
2: 0
3: 21
4: 178
Right 955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955004965 Original CRISPR AGGTTTCTTCAGATGAAGTC TGG Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
902922685 1:19676453-19676475 GTGTTTCTTCACATGAAATCTGG - Intronic
905921709 1:41723848-41723870 AGGTTTCTTCTGGTCAAGGCTGG + Intronic
906901106 1:49837263-49837285 AGGATTCTAGAGATGCAGTCTGG + Intronic
911021719 1:93396086-93396108 AGCTTTCTGAAGAAGAAGTCAGG + Intergenic
911206245 1:95094102-95094124 AAGTTTCTTCACATGATGACAGG - Intergenic
916240115 1:162631416-162631438 AGGTCTCTTTACAAGAAGTCTGG + Intronic
917196391 1:172470292-172470314 AGCATTCTTCAGATACAGTCAGG - Intergenic
918632992 1:186741246-186741268 AGCTTTCTTCACTTGAATTCTGG - Intergenic
918683269 1:187382469-187382491 AGGTTTAATCAAATGAAGTCTGG - Intergenic
921686446 1:218094613-218094635 AGGTTTCTACATATGAATTTTGG - Intergenic
1064277696 10:13921671-13921693 AGGTTTCAACAGATGAATTTTGG + Intronic
1065494210 10:26312344-26312366 AGGTTTCCACATATGAAATCTGG - Intergenic
1065615193 10:27513831-27513853 GGGTTTCTTCAGCTCAAGGCAGG + Intronic
1069649559 10:70035469-70035491 AGGTTTCAACATATGAATTCTGG + Intergenic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1072253467 10:93600183-93600205 AGGTTTCTTGAGCTGAGGTTTGG + Intronic
1075323164 10:121508684-121508706 AATTTTGTTCAGATGAAGTACGG + Intronic
1075912101 10:126133505-126133527 AGGTGTCTTCAGAGTAACTCTGG - Intronic
1075955530 10:126520040-126520062 ATGTTGCCCCAGATGAAGTCAGG - Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1079397522 11:20078162-20078184 AGGTTGCATCATATGATGTCAGG - Intronic
1080101580 11:28466051-28466073 AGCTATCTTCAATTGAAGTCGGG + Intergenic
1080762819 11:35269000-35269022 AGGTTTCGTCATATGAATTTTGG - Intronic
1081098805 11:38975349-38975371 AGGTTTCAACATATGAATTCAGG + Intergenic
1081524842 11:43920326-43920348 ATATTTCTTCAAATGAAGGCGGG - Intergenic
1082180774 11:49116601-49116623 AGTTTTATCCAGATGAAGGCAGG + Intergenic
1082300314 11:50496898-50496920 AGGTATCTTCAGATAAAAACTGG - Intergenic
1083262203 11:61529245-61529267 AGGTTTCTACAGGGGAAGTTGGG - Intronic
1083908745 11:65692657-65692679 AGGTTTATCCAGATGAACTGAGG + Intergenic
1085548355 11:77342591-77342613 AGGATTCTTCAGAGCCAGTCAGG + Intronic
1085865871 11:80291362-80291384 AGCTTTCTACAGAGGAAGTGAGG - Intergenic
1085883807 11:80498951-80498973 AGATTTCAACAGATGAATTCTGG - Intergenic
1086100354 11:83092847-83092869 AGGTTTCTTGTGGTGAAATCAGG + Intergenic
1086356126 11:86001656-86001678 AGGTTCCTTCAAAAGAAGACTGG + Intronic
1086549782 11:88042454-88042476 AGGTTTCTTCAGAGCACCTCAGG + Intergenic
1086684722 11:89718259-89718281 AGGTTTATCCAGATGAAGGCAGG - Intergenic
1087858092 11:103117645-103117667 AGGTTTGTTCAGAAAAAGTTGGG + Exonic
1088035953 11:105316010-105316032 GGTTTTGTTCAGATGGAGTCTGG + Intergenic
1090320812 11:125841976-125841998 AGGTTTCTGCATATGAATTTTGG - Intergenic
1093193034 12:16097044-16097066 ATGTTTCTTCACATGTAGTAAGG + Intergenic
1094392891 12:29971989-29972011 AGAATTCTTCAAATGAAGTTAGG - Intergenic
1095072550 12:37872242-37872264 AAATTTCTTCAGATGAAAACTGG - Intergenic
1096420001 12:51448945-51448967 AGGTTTCTTTTTAAGAAGTCAGG + Intronic
1097869710 12:64591061-64591083 AGGTTTCTTCACATTAATTCTGG + Intergenic
1100112923 12:91267664-91267686 AGATTTCTTTAGAAGAAGACAGG + Intergenic
1100425389 12:94480061-94480083 AGGTTGTTTCAGAAGAACTCAGG + Intergenic
1107970829 13:45640884-45640906 AGGAATCTTCAGAGGTAGTCTGG + Intergenic
1108552980 13:51565010-51565032 TGGTTTCATCTGATGAAGCCAGG + Intergenic
1110290946 13:73805994-73806016 AGGTTTCACCAGAGGAAGGCTGG + Intronic
1110512643 13:76369567-76369589 AGGTTTCTCCAGCTCAGGTCTGG - Intergenic
1111481650 13:88835230-88835252 TGTTTTCTTCAAATGAATTCAGG + Intergenic
1111730786 13:92073974-92073996 ATGTTTCTTCACATGATGGCAGG - Intronic
1112242628 13:97696917-97696939 AGGACTCTTCAGATGGAGTGAGG - Intergenic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1117674220 14:58139858-58139880 AGGTTTCAACACATGAATTCTGG - Intronic
1118173983 14:63419593-63419615 AGGATTCTTGAGACCAAGTCAGG + Intronic
1120579039 14:86223486-86223508 AGATTCCTTAAGAAGAAGTCAGG + Intergenic
1121306287 14:92909711-92909733 AGATTGCTTCAGAGGAAGGCAGG - Intergenic
1121413685 14:93764290-93764312 ACGATTCTTCAGCTGAAGGCGGG - Intronic
1125261046 15:37825058-37825080 AGGTTTCTAGAGACGCAGTCTGG - Intergenic
1126872943 15:53009221-53009243 AGGTTTGACCAGATTAAGTCAGG - Intergenic
1127638217 15:60891199-60891221 AGCTTCCTTCAGATAAAGTTTGG - Intronic
1131659993 15:94503975-94503997 AGGTTTCAACATATGAATTCTGG + Intergenic
1132988223 16:2779087-2779109 TGGTCTCTGCAGATGAAGCCTGG - Intergenic
1133143636 16:3767263-3767285 AGGTTTCTGCAGGTGCAGTGAGG - Intronic
1134335795 16:13298709-13298731 GGGTTTCGCCAGATGAAGTACGG - Intergenic
1135984224 16:27172262-27172284 AGGTTTCAGTAGATCAAGTCTGG + Intergenic
1136486184 16:30573096-30573118 GGGTTTCTCCATATTAAGTCAGG + Intergenic
1137863048 16:51866032-51866054 AGGCATCTTCAGATGAAGCAGGG + Intergenic
1139850253 16:69947681-69947703 ATTTTTCTTGAGACGAAGTCTGG - Intergenic
1139879238 16:70170594-70170616 ATTTTTCTTGAGACGAAGTCTGG - Intergenic
1140373285 16:74424958-74424980 ATTTTTCTTGAGACGAAGTCTGG + Intergenic
1141042401 16:80683633-80683655 AGGTTTCTTCATATGAAATTTGG - Intronic
1142392637 16:89812324-89812346 TGTTTTTTTGAGATGAAGTCTGG - Intronic
1148200296 17:45745826-45745848 TGGTTTCTTTATATGTAGTCGGG + Intergenic
1149812349 17:59689173-59689195 AGGCTCCTTCAGATGAAATGTGG - Intronic
1150451077 17:65269605-65269627 AGGTTTCAACATATGAATTCTGG + Intergenic
1154430721 18:14306453-14306475 AGGTTTCTCCATATGTACTCTGG - Intergenic
1157684346 18:49630642-49630664 AGGATTACTCAGATGGAGTCTGG - Intergenic
1161831407 19:6607287-6607309 TTGTTTTTTGAGATGAAGTCTGG - Intergenic
1161862861 19:6811422-6811444 GGCTCTCTCCAGATGAAGTCAGG - Intronic
1164810521 19:31151282-31151304 AGCATTCTTCAGATGAAATAAGG - Intergenic
925934446 2:8741755-8741777 AGTTTTCTTGAGTTGAAGTCTGG + Intronic
926108580 2:10167766-10167788 AGTTATCTTCAGATGAGGACAGG - Intronic
926349899 2:11984929-11984951 AGGTATCTGCAGCTGGAGTCTGG + Intergenic
926631685 2:15142421-15142443 AGGTTCCTGCAGATGACGTCAGG + Intergenic
928439990 2:31284400-31284422 AGGTTTCAACATATGAATTCTGG - Intergenic
929649875 2:43668042-43668064 TTGTTTTTTGAGATGAAGTCCGG + Intronic
929670253 2:43871751-43871773 AGGCTTCTGCAGATGTGGTCAGG + Intronic
929783827 2:44975005-44975027 AGGTTTCAACAGATGAAATTGGG - Intergenic
929792515 2:45034130-45034152 AGGTTGCTTGAGAGGAAGTTGGG + Intergenic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
932855738 2:75232346-75232368 AGGTTTCATCATATGAATTCTGG + Intergenic
932951231 2:76296086-76296108 AGATTTTTTCAACTGAAGTCAGG + Intergenic
933993785 2:87652602-87652624 AGGTTTCTCCATATGAATTCTGG + Intergenic
936168857 2:110149843-110149865 TGCTTTCTTCAGATAAAGTCAGG - Intronic
936300078 2:111298281-111298303 AGGTTTCTCCATATGAATTCTGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936813104 2:116426284-116426306 GGGCTTTTTCAGATGAAGTCTGG - Intergenic
938184970 2:129223394-129223416 AGGGTTCTTCAGTAGAAGACAGG - Intergenic
938185124 2:129224752-129224774 AGGGTTCTTCAGTAGAAGACAGG + Intergenic
939878738 2:147606179-147606201 AACTTTCTTCAGATGAGCTCAGG - Intergenic
940929436 2:159409558-159409580 AACTTTCTTCAAATTAAGTCTGG + Intronic
942925068 2:181421843-181421865 AGATTTCTACAGATGTAATCAGG + Intergenic
944127045 2:196305996-196306018 AGGTTTCAACATATGAACTCTGG - Intronic
944875249 2:203957917-203957939 AGGTTTCTTCACAGTAAGCCTGG + Intronic
948260753 2:236602806-236602828 AGGCTTCTTCTTATGAATTCTGG - Intergenic
948502118 2:238403188-238403210 GGGTGTCTTCTGATGAAGCCGGG + Intergenic
1169928207 20:10804961-10804983 AGGTTTCATCAAAGAAAGTCAGG + Intergenic
1172351947 20:34249978-34250000 AGGTTAGTTAAGATGAAGGCAGG - Intronic
1172558949 20:35868592-35868614 TGTTTTTTTGAGATGAAGTCTGG - Intronic
1175049476 20:56141148-56141170 AGGTTTCTTCATATGAAAAGTGG - Intergenic
1175598825 20:60256406-60256428 AGGTGCCTTCAGATGAATTAGGG + Intergenic
1175744054 20:61441514-61441536 AGGTTTCAGCAGATGAATTCTGG - Intronic
1177142493 21:17372470-17372492 ATGTTTCTTCAGGTGCATTCTGG - Intergenic
1177863529 21:26484215-26484237 AGGTTGGTTCAGGTCAAGTCTGG + Intronic
1178044113 21:28674976-28674998 AGGTTTCAACATATGAATTCTGG + Intergenic
1181443048 22:22948089-22948111 AGGTTTCAACATATGAATTCTGG + Intergenic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
949506372 3:4731899-4731921 AGGTCTCTTCAAAAGAACTCTGG + Intronic
951470973 3:23055610-23055632 AGGTTTCAACAGATGAATTTTGG + Intergenic
952494758 3:33906134-33906156 TGGCTTCTACAGATGAACTCTGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
954302188 3:49705909-49705931 AGGCTTCTTCAGACCCAGTCTGG - Intronic
954302224 3:49706112-49706134 AGGTAACCACAGATGAAGTCTGG + Intronic
955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG + Intronic
958156617 3:89762911-89762933 AGGTTTCAACACATGAATTCGGG - Intergenic
959027803 3:101260987-101261009 AAGATGCTTCAGATTAAGTCAGG - Intronic
959146388 3:102550746-102550768 AAGTTTCTTTAGGTAAAGTCTGG + Intergenic
959648772 3:108731425-108731447 AACTCTCTTCAGCTGAAGTCTGG - Intergenic
961562322 3:127739186-127739208 AGACTTCTTCAGATCAAATCCGG + Intronic
962884072 3:139607332-139607354 AGGTTTCTTAAGTTGAAGAAAGG - Intronic
964040670 3:152257636-152257658 GTGTTTGTTCTGATGAAGTCAGG + Intronic
964475618 3:157095441-157095463 AGGTTTGTTTAGATGTAGTCAGG + Intergenic
968036229 3:195550295-195550317 TGCTTTCTTCTGATGAAGTCTGG - Intergenic
970069307 4:12138484-12138506 AGTTTTCTTCATATGAATTTTGG + Intergenic
971376173 4:26057446-26057468 TGTCTTCTTCAGATGAGGTCTGG - Intergenic
971960742 4:33483866-33483888 ATTTTTCTTCAGCTGAAATCTGG + Intergenic
973221118 4:47729279-47729301 AAGTTTCTTCATAAGAATTCTGG + Intronic
973713915 4:53656192-53656214 AGGTTTCCTTCCATGAAGTCAGG + Intronic
976657108 4:87500384-87500406 AGTTGTCTCCAGATGAACTCTGG + Intronic
977270184 4:94908691-94908713 AGGTATCTGCAGCTGAAGACAGG + Intronic
977320678 4:95511854-95511876 AGTTTTCTTCTGAGGAAGTTGGG + Intronic
977357474 4:95965844-95965866 ATGTTTATTCAGAAGAGGTCAGG - Intergenic
977570051 4:98619980-98620002 AGGTTTCAACACATGAATTCTGG + Intronic
980265217 4:130506255-130506277 ATGTTTCTTCAGTTGAAGGAAGG - Intergenic
981615722 4:146641065-146641087 CGGCTTCTTCAGAGGAAGTGTGG + Exonic
982248017 4:153374331-153374353 AAGTTCCTTCTTATGAAGTCTGG - Intronic
986054019 5:4118233-4118255 GGGTTTCTTCTATTGAAGTCTGG + Intergenic
987235614 5:15938476-15938498 AGGCTTCATGTGATGAAGTCTGG - Exonic
987936543 5:24473535-24473557 AGGTTTCTTCAGATAAATCTGGG + Intergenic
988814453 5:34820066-34820088 AGTTTCCTTGACATGAAGTCTGG - Intronic
989735479 5:44698702-44698724 ATGTTTCTTAGGTTGAAGTCTGG - Intergenic
989777761 5:45229970-45229992 AGGTTTCAACATATGAATTCTGG - Intergenic
989841938 5:46086562-46086584 AAGTATCTTCAGATAAAATCTGG + Intergenic
989853702 5:46250745-46250767 AAATTTCTTCAGATAAAATCTGG - Intergenic
992911552 5:81400610-81400632 AGGTTTCAACAGATGAATTTTGG - Intergenic
994047687 5:95328189-95328211 AGGTTTCAACATATGAAGTCTGG - Intergenic
995616584 5:113971254-113971276 AGATTTCATCAGATGAAGAAAGG - Intergenic
996168357 5:120255614-120255636 AGTTTTATTCAGGTGAAGACAGG + Intergenic
997196852 5:131986060-131986082 AGATTTCTCCCGATGAAGTGTGG + Intronic
998003989 5:138645164-138645186 AGGTTTCTGGAGCTGTAGTCAGG - Intronic
998642127 5:144022886-144022908 AGGTTTCAGCAGATGAATTGTGG - Intergenic
998869553 5:146538482-146538504 AAGTTTTCTCAGATAAAGTCTGG + Intergenic
999404418 5:151294194-151294216 AGTTTTCTTCACATGCAGTCTGG + Intronic
1000553798 5:162698302-162698324 AGGTTCCTTGAGATTAAGGCAGG + Intergenic
1003929066 6:10905719-10905741 AGGGTTCATCAGATTAATTCTGG - Intronic
1004792341 6:19040673-19040695 GGCTTTCATCACATGAAGTCTGG + Intergenic
1008788721 6:55202747-55202769 AGGTTTCAACAAATGAAGCCGGG + Intronic
1009441890 6:63689870-63689892 AGATTTCTTCAAAGCAAGTCTGG - Intronic
1009889770 6:69666536-69666558 AAGCTTCTTCACATGATGTCGGG - Intergenic
1012137683 6:95578741-95578763 AGCTGTCTTTAGATGAAGTTTGG + Intronic
1013260553 6:108437164-108437186 AGGTTTCAACATATGAATTCTGG + Intronic
1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG + Intergenic
1013867567 6:114717463-114717485 AAGTTTCTTCAGAAGGTGTCTGG + Intergenic
1014337137 6:120150702-120150724 TGGCTTCATCAGATGAAGTAGGG - Intergenic
1014786004 6:125620018-125620040 AGGTTTCTTAAGGAGAACTCAGG + Intergenic
1016078236 6:139823750-139823772 AGGTCTCCTCAGAGGAGGTCTGG - Intergenic
1016529955 6:145047120-145047142 CGGTTTCTTCACTAGAAGTCTGG + Intergenic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1017487620 6:154917662-154917684 TATTTTTTTCAGATGAAGTCTGG + Intronic
1018755312 6:166843340-166843362 AGGTTTCTCCAGAGGTGGTCAGG - Intronic
1022251247 7:28610601-28610623 AGGTTTCTTCAAATGAAAAATGG + Intronic
1023513712 7:40979536-40979558 AAGTTTCACCAGATGCAGTCAGG - Intergenic
1023542716 7:41283300-41283322 ACGATTCTTCAGCTGAGGTCAGG + Intergenic
1024258164 7:47554728-47554750 TGGTTTCTTAAGATGGAATCGGG + Intronic
1024572620 7:50736272-50736294 TGTTTTTTTGAGATGAAGTCTGG - Intronic
1030113318 7:106044606-106044628 AAGTTTCTTCAAATGATGTTGGG - Intergenic
1034862674 7:154613172-154613194 AGGTTTCAACATATGAATTCTGG + Intronic
1035932097 8:3791594-3791616 AGGGTTGATCACATGAAGTCAGG + Intronic
1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG + Intronic
1038460409 8:27711429-27711451 AGGTTGGTTCAGAGGAATTCAGG - Intergenic
1039553433 8:38459780-38459802 AGTTTGCATCAGATGGAGTCAGG - Intronic
1044646810 8:94452235-94452257 AGGTTTCTACATATGAATTTTGG + Intronic
1045036507 8:98180391-98180413 AGGTTGCTTTTCATGAAGTCAGG - Intergenic
1047170051 8:122483965-122483987 AGTTTTGTTCAGCTGAAGTTGGG + Intergenic
1048571485 8:135660619-135660641 AGGTTTCATCATATGAATTTAGG + Intergenic
1052692755 9:31836114-31836136 AGGTTACTTCCGATGCAGGCTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054825413 9:69567962-69567984 AGTTTTCTGGGGATGAAGTCTGG - Intronic
1054952501 9:70868817-70868839 ATGTTTGTTCTGATGAAGACAGG - Intronic
1055663891 9:78534181-78534203 AGGTTTCAACATATGAATTCTGG - Intergenic
1055817910 9:80229757-80229779 AGGTTTCTACTGAAAAAGTCTGG + Intergenic
1056540996 9:87571385-87571407 GGGTCTCTTCACAAGAAGTCAGG - Intronic
1056886660 9:90449610-90449632 ACCTTTCCCCAGATGAAGTCAGG - Intergenic
1057177125 9:93008636-93008658 AGGACTCTTCAGGTGAAGTTGGG + Intronic
1060897431 9:127226303-127226325 AGGATCCTTAAGATGAAGTGCGG + Intronic
1062250372 9:135590927-135590949 GGGGTTGTTCAGATGAAGCCCGG - Intergenic
1187228530 X:17398115-17398137 AGGGATCTTGAGATAAAGTCTGG - Intronic
1187323711 X:18267044-18267066 AGATTCCTTAAGATGAAGACAGG - Intronic
1188933081 X:36139359-36139381 AGGTTTCCCCAGTTGAAGTTTGG + Intronic
1197627333 X:128816935-128816957 AGTTTTCAGCAGATGAATTCTGG - Intergenic
1198549105 X:137726063-137726085 AGGTTTCAACATATGAATTCAGG - Intergenic
1198741516 X:139848063-139848085 AGATTTCATCAGATGATGGCAGG - Intronic
1198823033 X:140669023-140669045 AGTTTTCTTAAGATGAAGTTAGG + Intergenic
1198881969 X:141291523-141291545 AGGTTTCAACATATGAATTCTGG + Intergenic
1200937998 Y:8755196-8755218 AGGTTTCTTCAGATTGGCTCAGG + Intergenic
1201338315 Y:12904202-12904224 AGCTTTCCTCAGGTGCAGTCAGG + Exonic
1201948722 Y:19540291-19540313 TTGTTTTTTCAGATGGAGTCTGG - Intergenic