ID: 955007590

View in Genome Browser
Species Human (GRCh38)
Location 3:54984058-54984080
Sequence TTCTGTTAAAGGGGCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955007590 Original CRISPR TTCTGTTAAAGGGGCCCCTC AGG (reversed) Intronic
900611296 1:3545657-3545679 TTCTGTGAAAGGGGCTCCACTGG - Intronic
900645995 1:3708959-3708981 TGCTGAGCAAGGGGCCCCTCAGG + Intronic
910337713 1:86154351-86154373 TTCTGTTACAGGGGCCACTGGGG - Intronic
922825971 1:228518943-228518965 CTCTATTAAAGGTGCCCCTGAGG + Intergenic
1063909018 10:10810957-10810979 TTCTTTCAAAGGGGACCTTCTGG - Intergenic
1067161004 10:43825371-43825393 TTCCCTTCAGGGGGCCCCTCAGG + Intergenic
1073771308 10:106738581-106738603 TTCTGTCACTGTGGCCCCTCTGG - Intronic
1076426194 10:130369324-130369346 TTCTGCTAAAGGGGAGCCACGGG + Intergenic
1078080541 11:8201614-8201636 TTCTGTTAAATGACCCACTCAGG + Intergenic
1079242844 11:18732930-18732952 TTCGGTTAAATGGGCCCTTATGG + Intronic
1083625619 11:64070591-64070613 CTCTGGGAAGGGGGCCCCTCCGG - Intronic
1084149962 11:67283434-67283456 ATCTGTGACAAGGGCCCCTCTGG - Intronic
1088051155 11:105517259-105517281 TTCTGTTAAAGGCTCTCTTCTGG + Intergenic
1088861401 11:113803206-113803228 TGCTGATGAAGGGGCCCCGCCGG - Exonic
1089565301 11:119368162-119368184 TCCTGGCCAAGGGGCCCCTCTGG + Intronic
1091453827 12:590540-590562 TTGTGTGAAAGGGGCACCTGCGG + Intronic
1093966718 12:25335371-25335393 TTCTGTGAAAGAGGCCCCATAGG + Intergenic
1095968568 12:47885427-47885449 TTCTGTTAAATGGGCATCCCCGG + Intronic
1097869965 12:64593689-64593711 TTCTGTTAAAGGAACCTCTAAGG + Intergenic
1101556315 12:105813268-105813290 ATTTGTTAAATGGGCCACTCTGG - Intergenic
1102569137 12:113816834-113816856 TCCTGTGAAAGCGGCCTCTCGGG - Exonic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1112771722 13:102800241-102800263 TGGTGTTAAAGGGGGCCCACGGG - Intronic
1113967405 13:114161865-114161887 TTCTGCACCAGGGGCCCCTCTGG - Intergenic
1124905846 15:33867766-33867788 TGCAGTTAAAGGGGCCCTTGGGG - Exonic
1127585428 15:60373504-60373526 TGCTGTAAAAGTTGCCCCTCTGG + Intronic
1127815778 15:62607628-62607650 TTCTGTAGAAGGGGCCCTTTTGG + Intronic
1128498535 15:68211462-68211484 TTCTGTTACAGGGGCCCAGGTGG + Intronic
1128736627 15:70057361-70057383 ACATGCTAAAGGGGCCCCTCAGG - Intronic
1130088062 15:80795250-80795272 TTTTTTTAAAGGGATCCCTCTGG + Intronic
1133572716 16:7057403-7057425 TTCTGTTTATGGGTCCACTCTGG + Intronic
1135655280 16:24243163-24243185 TTCTGTTGAAGGTTCCCCTGGGG + Intergenic
1151229825 17:72676322-72676344 TTCTGTTGAAGGCACCCTTCTGG - Intronic
1151707838 17:75780192-75780214 TTTTGTTAAAGTAGCCTCTCTGG - Intronic
1157303181 18:46495373-46495395 TTCTGTTAAAAAAGTCCCTCAGG - Intronic
1164056268 19:21624516-21624538 CCCTGTTGAAGGGGCCCCACAGG - Intergenic
932727287 2:74190359-74190381 TTCAGTTTAAGGGGCACCTCTGG - Intergenic
938928579 2:136066292-136066314 TTGTGTTAATGCTGCCCCTCAGG - Intergenic
942013882 2:171791703-171791725 TGCTGTTTAAGGGACACCTCAGG - Intronic
947403705 2:229753283-229753305 TTCAGTTAAAGGGTTACCTCTGG - Intergenic
947485686 2:230546397-230546419 TTTTGTTACAGGGGCCCCAGAGG - Intergenic
1170387227 20:15832546-15832568 TTCTGTTTCAGGGGCACCTGTGG - Intronic
1171205980 20:23281813-23281835 TTCTTTTAAATGGGCCACACTGG - Intergenic
1175869624 20:62202290-62202312 TTCTTTCTTAGGGGCCCCTCAGG - Exonic
1180905018 22:19404286-19404308 GTCTGGTAAAGGAGCCCCACTGG + Intronic
1181468820 22:23125664-23125686 ATCTGTAAAATGGGCACCTCTGG - Intronic
1181625884 22:24121802-24121824 TTCTGTTCAAGTGCCTCCTCAGG + Intronic
1181859034 22:25804224-25804246 TTGTGTGAAAAGGGCCACTCTGG - Intronic
1185225162 22:49647982-49648004 CTCTATCAAATGGGCCCCTCTGG - Intronic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
955007590 3:54984058-54984080 TTCTGTTAAAGGGGCCCCTCAGG - Intronic
966827511 3:183977434-183977456 CTCTGTTCAAGGGGCCACCCAGG - Intronic
968704454 4:2071514-2071536 TTCTCATAGAGGGGCTCCTCTGG + Intergenic
971378282 4:26073225-26073247 TTCTATTGAAGGGGTCACTCAGG + Intergenic
971884702 4:32428408-32428430 TTCAGTTAAAGTGGATCCTCAGG + Intergenic
975622939 4:76312204-76312226 TTCTGTTAATGAGAACCCTCAGG + Intergenic
976336468 4:83893794-83893816 ATCTGTTATAGGGGACCCACTGG + Intergenic
985270548 4:188190538-188190560 TTCTGTTAATGTGGCATCTCAGG + Intergenic
989448473 5:41559090-41559112 TTTTGGTAAAGGGGCCACTCAGG + Intergenic
992561667 5:77958238-77958260 AGCCGTTAAAGAGGCCCCTCTGG - Intergenic
1002323608 5:178390461-178390483 TTCTGTGCCAGGGGACCCTCGGG - Intronic
1002648421 5:180673870-180673892 TTCTGATAAAGGAGCTCGTCCGG - Intergenic
1003283099 6:4711242-4711264 TTAGGTTAAAGGGCCTCCTCTGG - Intronic
1005438575 6:25840422-25840444 TTCTGTTAGAGGGCTCCCTCAGG - Intronic
1007593971 6:43040177-43040199 ATCTGTTCAAAGTGCCCCTCAGG + Exonic
1009886336 6:69628242-69628264 TTATGTTAAAAGGACCACTCTGG - Intergenic
1011433621 6:87314637-87314659 TTCTGGGCAAGTGGCCCCTCAGG + Intronic
1018036460 6:159886837-159886859 CTTTGTTAAAAGGGCCCCTGAGG - Intergenic
1023719864 7:43081650-43081672 TTCTGTTTAAAATGCCCCTCCGG + Intergenic
1023827002 7:44016382-44016404 CTGTGTTTAATGGGCCCCTCTGG - Intergenic
1029755287 7:102569783-102569805 CTATGTTTAATGGGCCCCTCTGG - Intronic
1029773235 7:102668863-102668885 CTATGTTTAATGGGCCCCTCTGG - Intronic
1036102426 8:5801844-5801866 CCCTGTTAAAGGGGCCCCATAGG + Intergenic
1037527349 8:19740010-19740032 TTTGGTTAAAGGGGCCCAGCAGG - Intronic
1038282980 8:26182410-26182432 GTCTGTTAAAGAGGGCCCTTGGG - Intergenic
1043472949 8:80579103-80579125 TCCTGTTAAATGGGGCCATCTGG - Intergenic
1049289128 8:141792234-141792256 ATCTGTGAAATGGGCCCATCAGG - Intergenic
1056300706 9:85237678-85237700 TTCTGTAAATGGGGCCTCTGGGG - Intergenic
1058827560 9:108788415-108788437 TTCTGTTAGAGGGTCCCCAAAGG - Intergenic
1186721746 X:12312146-12312168 TTCTGTTAAAGGTGTCCATTGGG + Intronic
1189020935 X:37338936-37338958 TTCTGTTCAATAGGCCTCTCTGG - Intergenic
1189027681 X:37414527-37414549 ATCTTCTAAAGGGGCCCCTGAGG + Intronic
1189516868 X:41721215-41721237 TTCTGTAAAAGTGGCCCCTTTGG - Intronic
1189709857 X:43798239-43798261 TTTTGTTAAAGGGGACACTATGG - Intronic
1192437879 X:71153959-71153981 TTCTGGGAGAGGGGCCCCGCAGG + Intronic
1195418951 X:104652189-104652211 TGCAGTTAAAGAAGCCCCTCTGG + Intronic
1195998649 X:110758157-110758179 TTCTGATAAAGTTGCCACTCTGG - Intronic
1197772070 X:130095540-130095562 CTCTGTTGAAGCGGCCCCACAGG - Intronic
1198343098 X:135733801-135733823 TTCGGGTAAAGGGGAACCTCGGG + Intergenic
1198344891 X:135749494-135749516 TTCGGGTAAAGGGGAACCTCGGG - Intergenic
1201401540 Y:13609101-13609123 TTCTGTTGAAGGGGCCCCATAGG - Intergenic
1201520964 Y:14873210-14873232 TCCTGTTGAAGGGGCCCCATAGG + Intergenic