ID: 955009991

View in Genome Browser
Species Human (GRCh38)
Location 3:55004533-55004555
Sequence GGGAACGAAGGTATTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955009991_955009997 0 Left 955009991 3:55004533-55004555 CCCTTTCCAATACCTTCGTTCCC 0: 1
1: 0
2: 1
3: 15
4: 201
Right 955009997 3:55004556-55004578 TTTGTCCTTCAAATTCCAAGTGG 0: 1
1: 0
2: 3
3: 19
4: 228
955009991_955010000 26 Left 955009991 3:55004533-55004555 CCCTTTCCAATACCTTCGTTCCC 0: 1
1: 0
2: 1
3: 15
4: 201
Right 955010000 3:55004582-55004604 CATGACTGTGCCTCCAGCACTGG 0: 1
1: 0
2: 2
3: 12
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955009991 Original CRISPR GGGAACGAAGGTATTGGAAA GGG (reversed) Intronic