ID: 955009991 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:55004533-55004555 |
| Sequence | GGGAACGAAGGTATTGGAAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 201} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955009991_955009997 | 0 | Left | 955009991 | 3:55004533-55004555 | CCCTTTCCAATACCTTCGTTCCC | 0: 1 1: 0 2: 1 3: 15 4: 201 |
||
| Right | 955009997 | 3:55004556-55004578 | TTTGTCCTTCAAATTCCAAGTGG | 0: 1 1: 0 2: 3 3: 19 4: 228 |
||||
| 955009991_955010000 | 26 | Left | 955009991 | 3:55004533-55004555 | CCCTTTCCAATACCTTCGTTCCC | 0: 1 1: 0 2: 1 3: 15 4: 201 |
||
| Right | 955010000 | 3:55004582-55004604 | CATGACTGTGCCTCCAGCACTGG | 0: 1 1: 0 2: 2 3: 12 4: 227 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955009991 | Original CRISPR | GGGAACGAAGGTATTGGAAA GGG (reversed) | Intronic | ||