ID: 955012204

View in Genome Browser
Species Human (GRCh38)
Location 3:55029084-55029106
Sequence GAGAACAGTCTAAAGACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955012204_955012209 19 Left 955012204 3:55029084-55029106 CCACAAGTCTTTAGACTGTTCTC 0: 1
1: 0
2: 2
3: 9
4: 142
Right 955012209 3:55029126-55029148 TTTCTACCAAGTGAGGCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 174
955012204_955012208 12 Left 955012204 3:55029084-55029106 CCACAAGTCTTTAGACTGTTCTC 0: 1
1: 0
2: 2
3: 9
4: 142
Right 955012208 3:55029119-55029141 GCAGGTGTTTCTACCAAGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 123
955012204_955012205 -6 Left 955012204 3:55029084-55029106 CCACAAGTCTTTAGACTGTTCTC 0: 1
1: 0
2: 2
3: 9
4: 142
Right 955012205 3:55029101-55029123 GTTCTCAGTGAGTGCCCTGCAGG 0: 1
1: 0
2: 2
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955012204 Original CRISPR GAGAACAGTCTAAAGACTTG TGG (reversed) Intronic
903815491 1:26061343-26061365 GAGAACAGTCACAAGTCATGGGG + Intronic
906254910 1:44341006-44341028 GAGAAGAGTCTAAGTCCTTGAGG - Intronic
911723607 1:101218368-101218390 GAGAAAAAACTATAGACTTGAGG + Intergenic
911870077 1:103086253-103086275 TAGAACTGAATAAAGACTTGAGG + Intronic
912352379 1:109026460-109026482 AAGAATTGTCTAAAGATTTGAGG - Intronic
914824112 1:151128909-151128931 GAGAACAGGCTACAGAATAGAGG - Intergenic
918143015 1:181733979-181734001 GTGATCACTCTGAAGACTTGAGG - Intronic
920654475 1:207865483-207865505 TAGAAGAGGCCAAAGACTTGTGG + Intergenic
921032804 1:211348889-211348911 GATAACACTCTTAAAACTTGAGG - Intronic
922087522 1:222365067-222365089 GAGATCAGTCTAATGCCTTTGGG - Intergenic
1068543190 10:58319170-58319192 GAGAAAAGGCTTAAGACTTTGGG - Intergenic
1071637605 10:87271173-87271195 GAGTACAGTCAATAGACTTCTGG - Intergenic
1071657640 10:87466778-87466800 GAGTACAGTCAATAGACTTCTGG + Intergenic
1073575944 10:104623316-104623338 GAGAACAGTCTCAGTGCTTGTGG + Intergenic
1074592717 10:114828592-114828614 GAGAACATTCTAAAAACAAGTGG + Intronic
1076017325 10:127038491-127038513 GACAACAGTAAAAAGACCTGAGG - Intronic
1078150559 11:8756156-8756178 GAGAAAAGGCAAAAGATTTGTGG + Intronic
1080005484 11:27401841-27401863 GAGAAAAGTCAATAGAGTTGAGG + Intronic
1080520542 11:33064600-33064622 GAGAACAATCTAAAGCCTCCCGG - Intronic
1081131473 11:39385998-39386020 GATAACTGTGTGAAGACTTGTGG - Intergenic
1082188983 11:49218917-49218939 GAGAACAAAATAAAAACTTGGGG - Intergenic
1086590064 11:88504538-88504560 GACAACATTCTAAACATTTGAGG + Intergenic
1086677541 11:89627707-89627729 GAGAACAAAATAAAAACTTGGGG + Intergenic
1090876885 11:130798192-130798214 GAAAACAGTCTCAAGGCTTGAGG + Intergenic
1090880685 11:130829291-130829313 GAGAGCATTCTTAAGTCTTGAGG + Intergenic
1097532569 12:60823243-60823265 AAGAACAATCTAAAGATCTGGGG + Intergenic
1099336095 12:81360042-81360064 GAAAACAGTCTCAACACATGTGG + Intronic
1099761568 12:86927900-86927922 GAAAATACTCTAAAGAATTGTGG - Intergenic
1101680712 12:106961658-106961680 GAAAACAGGCTAAATATTTGGGG + Intronic
1104735715 12:131135008-131135030 GAGAAAAGTCTAGAGACTAGCGG - Intronic
1106386696 13:29292467-29292489 TAGAACAGTCTTAACCCTTGAGG + Intronic
1107378732 13:39832880-39832902 GAGAACTAGCTAAAGACTTGAGG - Intergenic
1113009507 13:105747724-105747746 AACTACGGTCTAAAGACTTGCGG + Intergenic
1113136770 13:107099395-107099417 GAGAACAATATAAAGAAATGAGG - Intergenic
1114543919 14:23484387-23484409 GCTAACAGTCTAAAGAGTTTGGG - Intronic
1117386452 14:55218623-55218645 GAGACCATTCAAAAGGCTTGTGG - Intergenic
1124128637 15:26964727-26964749 GAGAACAGTTTTAAAAATTGGGG + Intergenic
1124825380 15:33089187-33089209 GAGTACAGCCAATAGACTTGGGG - Intronic
1125698905 15:41662178-41662200 AAACACAGGCTAAAGACTTGAGG + Intronic
1128532742 15:68465633-68465655 GAGAACTGGCTGAAGACTGGTGG - Intergenic
1130771753 15:86931128-86931150 AAGCATTGTCTAAAGACTTGGGG - Intronic
1132360708 15:101211956-101211978 GAGAACAACTTCAAGACTTGGGG + Intronic
1135760294 16:25132549-25132571 GAAAAAAATCTAAACACTTGGGG - Intronic
1138076946 16:54051999-54052021 CAGAACACTCTCTAGACTTGTGG + Intronic
1139204308 16:65012039-65012061 GAGAACAGTCTACATATTGGAGG - Intronic
1140249155 16:73279703-73279725 CAGAACAGGCTGAAGACATGAGG + Intergenic
1141487048 16:84347344-84347366 CAGAACATTCTAGAGACTTCTGG - Intergenic
1143694924 17:8606858-8606880 GCCAAGAGTCTGAAGACTTGAGG - Intronic
1143937713 17:10504673-10504695 TAGAACATTCTAAGGAGTTGTGG + Intronic
1144013733 17:11174148-11174170 GAGAACAGATTAATGATTTGCGG + Intergenic
1144137962 17:12317196-12317218 GACAACAGTCTAAAGAAATCTGG + Intergenic
1144577303 17:16437166-16437188 GAGGACAGTCCCCAGACTTGGGG - Intergenic
1150199457 17:63339337-63339359 GAGAACAGCCAGAAGACCTGGGG + Intronic
1155689816 18:28605808-28605830 GAGAACAGCCAAGAGACTTGTGG + Intergenic
1158875016 18:61725189-61725211 GAGAACTTGCTAAAGACATGGGG - Intergenic
1159750069 18:72289349-72289371 GAGAACAGCATAAAGAATTAGGG + Intergenic
1160377740 18:78426506-78426528 GAAAACAGTTTAAAGACTTGAGG + Intergenic
925513332 2:4651807-4651829 TAAAACAGTCCAGAGACTTGAGG - Intergenic
931251869 2:60538813-60538835 GAGTACAGTGTAAATATTTGTGG - Intronic
932020624 2:68082480-68082502 GAGAGAATTCCAAAGACTTGTGG + Intronic
933204445 2:79489346-79489368 GATTATAGTCAAAAGACTTGGGG + Intronic
939073551 2:137572175-137572197 GAGAACAATGGAAAGACTAGAGG - Intronic
939565248 2:143779489-143779511 GAGAAAAGTTTAAAGTCTTCGGG + Intergenic
943054126 2:182954524-182954546 GAGCACAGTCTTAGGACTTAGGG - Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
944546900 2:200807777-200807799 GAGAACAGTGTAATGGCATGTGG - Intergenic
945414743 2:209557216-209557238 GAGACCAGACAACAGACTTGTGG + Intronic
946952414 2:224891892-224891914 GAGAACTGTCTTAATTCTTGGGG + Intronic
1173439534 20:43063708-43063730 GAGAGCCTTCTAAAGACTTAAGG + Intronic
1177502385 21:21974563-21974585 GAGAACACTCTAAAGACTTTAGG + Intergenic
1179970107 21:44831865-44831887 GAGAATTGTTTAAAGAGTTGAGG - Intergenic
1182326891 22:29519991-29520013 GAGATCAGTGTACAGACCTGGGG + Exonic
1182444353 22:30381355-30381377 GAGAACACTTTAAAGCCTGGGGG + Intronic
949295867 3:2521714-2521736 GAGAAAAGTCAATAGACTTGGGG - Intronic
949711330 3:6874365-6874387 GGGTACAGTTTAAAGACTTCTGG - Intronic
951975567 3:28503760-28503782 ATGAAAAGTCAAAAGACTTGTGG - Intronic
952086220 3:29824991-29825013 AAGAACAGTTTGAAGACTTTGGG - Intronic
952188227 3:30993658-30993680 GGGAACTTCCTAAAGACTTGTGG - Intergenic
952328402 3:32341574-32341596 TAGTACAGTTTAAAAACTTGAGG + Intronic
955012204 3:55029084-55029106 GAGAACAGTCTAAAGACTTGTGG - Intronic
958662079 3:97082734-97082756 GAGAAAAGACTAAATACTCGTGG - Intronic
959901683 3:111668910-111668932 GAGAACATTTTAAAGACAGGAGG + Intergenic
963990348 3:151646150-151646172 GAGCAAAGTGTAAAGACTTCAGG - Intergenic
965239443 3:166176197-166176219 GAAAACAGTCTAAATGCTTAAGG - Intergenic
966823195 3:183941334-183941356 GAGAACAGTAAAAAGGCTTGGGG + Intronic
967602377 3:191405234-191405256 TAGAGCTGTCTAAAGCCTTGGGG - Intergenic
970406096 4:15765801-15765823 GGGAACAGGATAAAGACTTGGGG - Intergenic
970888282 4:21012140-21012162 GAGAACAGAGTCAAGCCTTGTGG + Intronic
970967635 4:21947410-21947432 GAGAACAGTCTTAATCCTTTTGG - Intronic
973851785 4:54967934-54967956 GAGAACTGGCTAAACACTGGAGG + Intergenic
976447502 4:85148693-85148715 GAGGAAACTCAAAAGACTTGAGG - Intergenic
980622906 4:135332532-135332554 GAGAACACTTTAAAAACTTAAGG + Intergenic
981045894 4:140264668-140264690 GAGAACACTCAAAAGTCATGTGG - Intronic
984199478 4:176699980-176700002 GAGAACAGTGAACAGAGTTGGGG + Intronic
984302511 4:177940661-177940683 TAAGACATTCTAAAGACTTGTGG + Intronic
985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG + Intronic
988266048 5:28952411-28952433 GAGATCAGTCTAACGACTGATGG + Intergenic
992188874 5:74270565-74270587 TAGAATAGTCTAAACAATTGTGG - Intergenic
992309617 5:75482338-75482360 GAGAAGAGTGGAAGGACTTGTGG + Intronic
992753303 5:79881013-79881035 GAGAATACTCAAAAGATTTGAGG - Intergenic
993089446 5:83406534-83406556 GAGAACAGTGATAAGATTTGTGG - Intergenic
995784240 5:115811771-115811793 GAGAAAAGACAAAAGCCTTGGGG - Intronic
998385091 5:141752992-141753014 GAGAACTGATTTAAGACTTGAGG + Intergenic
1003760048 6:9169503-9169525 GGCAAGAGTCAAAAGACTTGAGG + Intergenic
1005627984 6:27681417-27681439 GACAACAGTCAAAAAACTGGGGG + Intergenic
1005731906 6:28705848-28705870 GAGAAAAGTCTGAAGAGTTAAGG + Intergenic
1009897763 6:69774374-69774396 GAGAACAGGCTAATAACATGAGG + Intronic
1013796697 6:113896459-113896481 GACTACAGTATAAACACTTGGGG - Intergenic
1014141711 6:117951203-117951225 TGGAAAAGTCTAAAGATTTGTGG + Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016497062 6:144675459-144675481 GTGAACAGACTCAGGACTTGTGG + Intronic
1016640465 6:146342587-146342609 ATGAACAATCTAAAGACTAGTGG - Intronic
1017077456 6:150632003-150632025 GAGAACAGTCTCACAACTTCAGG + Intronic
1017494237 6:154969192-154969214 TAGAACAGTCCAATGACCTGAGG + Intronic
1019615789 7:1960020-1960042 GACAACAGTATAAAGGCTGGAGG + Intronic
1020824254 7:13007582-13007604 GAAAACAGTGAAAGGACTTGAGG - Intergenic
1021747987 7:23762993-23763015 CAGAACAATCTAAAGTCTTAAGG - Intronic
1021877140 7:25059655-25059677 GATGACAGTCTAGAGCCTTGGGG + Intergenic
1022343417 7:29489352-29489374 AAGAACAGTTTGAAAACTTGAGG - Intronic
1025761475 7:64399965-64399987 GAGAAAAGTCACAAAACTTGGGG - Intergenic
1026262145 7:68764651-68764673 GGGCACAGTCTAAAGATTTGGGG - Intergenic
1027544692 7:79512779-79512801 GATAACAGTCTAATGATATGAGG + Intergenic
1030337515 7:108342290-108342312 CAGAACAGGCTAAATACTTAGGG + Intronic
1030750273 7:113224398-113224420 GAGAACAATCAAAAGTCTAGAGG + Intergenic
1031627012 7:124003806-124003828 GAGTACAGTCAATAGACTTCTGG + Intergenic
1031791955 7:126117993-126118015 GTGTACAGTCTAGGGACTTGGGG + Intergenic
1033023077 7:137746792-137746814 GAGAACATATTAAAGTCTTGAGG - Intronic
1033811495 7:145018103-145018125 GAGAACAGTCAACAGACAAGAGG + Intergenic
1034202334 7:149290259-149290281 GAGACCAGTCTGGAGGCTTGAGG + Intronic
1037648193 8:20812904-20812926 GAGAACAAACAAAAGAATTGAGG - Intergenic
1039323187 8:36455477-36455499 GAGCACAGTCTAAAAAGTGGAGG - Intergenic
1039576331 8:38626723-38626745 GAAAACTCTCTAGAGACTTGTGG - Intergenic
1040106383 8:43544618-43544640 CAGAACAGTAGAAGGACTTGTGG + Intergenic
1042159589 8:65879039-65879061 GAGAACCATCTACAAACTTGGGG - Intergenic
1043821194 8:84867141-84867163 GAAAACAGTGTGAAGACATGGGG - Intronic
1046418186 8:113942417-113942439 CAGAAGAGTCTCAAGAATTGTGG - Intergenic
1050935926 9:11394260-11394282 GAGAACAGTATTAAGACATTCGG - Intergenic
1054879068 9:70126118-70126140 GAGCACAGTGTTAAGAGTTGGGG - Intronic
1056728781 9:89145758-89145780 GAGAACATTCTAAAGTCCTCGGG + Intronic
1057022175 9:91707787-91707809 GAGAACAGAGTTAAGAGTTGAGG + Intronic
1185510489 X:660466-660488 GAGAACAGGCTACAGACAAGAGG - Intergenic
1185559764 X:1050556-1050578 GAGAGCAGCCTAAACATTTGGGG + Intergenic
1186404794 X:9292528-9292550 AACAACATTCTAAAGACTCGAGG + Intergenic
1187463383 X:19507345-19507367 GTGAACATCTTAAAGACTTGAGG - Intronic
1188111922 X:26204553-26204575 GAGAAAATTCTAAAGACTGGTGG + Intergenic
1188312264 X:28631674-28631696 GAGAAAAGCTTAAAGATTTGGGG - Intronic
1189113742 X:38322037-38322059 GAGCATAGTCTAAACACCTGAGG - Intronic
1189170777 X:38907260-38907282 GAGAACAGTCTAACTGCTGGGGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195394085 X:104392366-104392388 GAATACAGTCTATAGCCTTGAGG + Intergenic
1196553619 X:117060691-117060713 AAGGACAGTCCAAAGCCTTGGGG - Intergenic
1198791381 X:140350593-140350615 GAGACAAATCTAAAGACTGGAGG + Intergenic
1201465779 Y:14278938-14278960 GAGCTTTGTCTAAAGACTTGTGG + Intergenic