ID: 955013035

View in Genome Browser
Species Human (GRCh38)
Location 3:55038257-55038279
Sequence ATGTTCACCTTAATAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955013035_955013036 15 Left 955013035 3:55038257-55038279 CCTTAGATTATTAAGGTGAACAT 0: 1
1: 0
2: 2
3: 14
4: 142
Right 955013036 3:55038295-55038317 TCATCCTACAATTTTCACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955013035 Original CRISPR ATGTTCACCTTAATAATCTA AGG (reversed) Intronic
904225934 1:29019531-29019553 ATTTTCACATTAATATGCTAAGG - Intronic
905613113 1:39372665-39372687 ATTTTCACTTTAATTATATAAGG - Intronic
907130169 1:52090275-52090297 ACCTTCACCTTAATAATTTAGGG - Exonic
908437842 1:64124138-64124160 ATATTAACCTTAATTATCTGTGG + Intronic
909495792 1:76277040-76277062 ATGTTCTGCTTACTAATCCAGGG + Intronic
912758519 1:112345507-112345529 ATTTTCACAGTAATACTCTAAGG + Intergenic
918848529 1:189651058-189651080 TTGTTCACCTTAGCAATTTAAGG + Intergenic
919003592 1:191866778-191866800 CTGTACACATTTATAATCTATGG - Intergenic
919370046 1:196711876-196711898 ATATTCAGCCAAATAATCTAGGG + Intronic
919383149 1:196883252-196883274 ATATTCATCCAAATAATCTAGGG + Intronic
923052949 1:230401654-230401676 ATTTTACCCTTCATAATCTAGGG + Intronic
923558700 1:235022047-235022069 TTGTTCACTTTAAAAATGTAAGG + Intergenic
924176191 1:241393632-241393654 ATGTTCAGCTTTAGAATATATGG - Intergenic
1064401864 10:15028189-15028211 GTGATCACCTTAATAATAAAGGG + Intergenic
1065330722 10:24595637-24595659 TTGTTCAATTTAATATTCTATGG + Intronic
1067379070 10:45755818-45755840 ATGTGCACCTTAGGGATCTAGGG - Intronic
1067886773 10:50096481-50096503 ATGTGCACCTTAGGGATCTAGGG - Intronic
1068184026 10:53562568-53562590 ATCTGCACCTTAATGATCTTTGG + Intergenic
1069202970 10:65646022-65646044 ATTTTCACCTTAAGAAACTAGGG - Intergenic
1069215108 10:65810496-65810518 ATTTTCACCTTTATAATCCCTGG + Intergenic
1069765986 10:70860553-70860575 CTGTTCACCTCAGTACTCTAAGG - Intronic
1073826956 10:107335644-107335666 ATGTACTCCTGAATAATCAATGG - Intergenic
1074254037 10:111782610-111782632 ATCTTCACCTGAATGATATATGG - Intergenic
1082007920 11:47430482-47430504 AAGGTCCCCATAATAATCTAGGG - Intergenic
1082180413 11:49111022-49111044 AAGTTCTCTTTAACAATCTAAGG - Intergenic
1086109568 11:83184730-83184752 ATGTTCAACATAATATTCAAGGG - Exonic
1086110348 11:83192420-83192442 GTGATCACCTTAATAATAAAGGG + Intergenic
1086309046 11:85516184-85516206 ATCTTCTCCTGAATAATCTTTGG + Intronic
1086685080 11:89723820-89723842 AAGTTCTCTTTAACAATCTAAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1093251906 12:16816188-16816210 ATGTTAACCTTATTAATCAATGG + Intergenic
1093269532 12:17042335-17042357 ATATTCACTTTAATATTCTGGGG + Intergenic
1094876610 12:34652848-34652870 TTTTTCACCTTAAGAATCAATGG - Intergenic
1096019476 12:48311247-48311269 ATGTTCTACTTAAAAATCAAAGG - Intergenic
1097513892 12:60578342-60578364 ATGTTCAGAATAAAAATCTATGG - Intergenic
1097631604 12:62070961-62070983 AACTTCACATTAATAATGTAAGG - Intronic
1097724321 12:63057429-63057451 ATGTGCACAATAATAACCTATGG + Intergenic
1099533461 12:83816768-83816790 TTGTTCACCTTAACCATTTAAGG - Intergenic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1101998686 12:109543285-109543307 ATGTTCACTGGAATAATCCACGG + Intergenic
1107901763 13:45023434-45023456 ATGTTCAATTTACTAATATAAGG + Intronic
1108150392 13:47527815-47527837 AGGTTCAACTTGTTAATCTAAGG + Intergenic
1108957614 13:56180630-56180652 ATATTTATCTTAATAATTTAAGG - Intergenic
1109089196 13:58017492-58017514 CTGTGAACCTGAATAATCTATGG + Intergenic
1111132160 13:83991312-83991334 ATATTAGCCTTAATAATATATGG + Intergenic
1114508430 14:23236208-23236230 ATGTTAATATAAATAATCTATGG - Intronic
1116160005 14:41256235-41256257 ATATTCACCTTAATTATCAATGG - Intergenic
1116294193 14:43084803-43084825 AGGCTCACCTGAATAATCCAAGG + Intergenic
1117721438 14:58632283-58632305 ACTTTCATGTTAATAATCTAGGG + Intergenic
1118195851 14:63625299-63625321 TTGTGCCCCTTAATAATCAATGG - Intronic
1125411251 15:39408774-39408796 ATGATCACTTGGATAATCTAAGG - Intergenic
1126473094 15:49036709-49036731 ATGTTCAAGTTAATATTCTGAGG - Intronic
1127545654 15:59992861-59992883 ATGTTCAGTTTAATTTTCTATGG - Intergenic
1128625926 15:69203439-69203461 ATGTTCAACTTACTAAACAAAGG - Intronic
1129086690 15:73101344-73101366 ATGTGCACATTAATAGTCAAGGG + Intronic
1132219501 15:100094686-100094708 ATGTTCAATTTAATAAACAAAGG + Intronic
1134270403 16:12727873-12727895 ATCTTCACCTTACAAATGTATGG + Intronic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1140497527 16:75402456-75402478 ATGTTTAGCTTATTAACCTAGGG - Intronic
1141110031 16:81264894-81264916 TGGTCCACCTCAATAATCTACGG - Intronic
1144182655 17:12767226-12767248 ATCTTCACCTGAATAATAGAGGG + Exonic
1147200468 17:38798540-38798562 ATGATCACCTTCAAAAACTATGG + Intronic
1152633792 17:81422328-81422350 ATTTTCACCATAATAAGCTCAGG - Intronic
1155468770 18:26168908-26168930 ATATTCACCCAAATAATCAAGGG - Intronic
1155531601 18:26772479-26772501 ATTTTCACCTTAGTAGACTAAGG + Intergenic
1162957089 19:14105160-14105182 ATTTTCACATTGATAATATATGG + Intronic
1164190244 19:22909233-22909255 ATGTTGACCTTAAAATTTTAGGG + Intergenic
1164487030 19:28667399-28667421 ATGTTCACCATAATAAAATGAGG - Intergenic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
929324607 2:40593548-40593570 AATTTCACCTTCATTATCTAAGG + Intronic
930322337 2:49871877-49871899 ATTTTCACTTTAATATTCTTTGG + Intergenic
932282623 2:70507333-70507355 GTGTTCACATTAATGATCTCTGG - Intronic
933293779 2:80467508-80467530 AACTTCACTTTAATGATCTAGGG + Intronic
935432568 2:102992043-102992065 ATGTCCACCAGAATTATCTATGG - Intergenic
935515942 2:104038932-104038954 ATGTTCACAAGAATAATATAGGG - Intergenic
936657305 2:114503298-114503320 ATGTTCACCTTAAAAATGACTGG + Intronic
936763197 2:115811660-115811682 TTGTTCACCTTTATAAACTCTGG - Intronic
938155604 2:128937553-128937575 ATCTTCACCATAAAAATCTAGGG - Intergenic
939595348 2:144116122-144116144 ATGTACACCATAACATTCTATGG + Intronic
942705829 2:178770823-178770845 AGGTTCCCCTAAATAATCTCAGG - Intronic
945608012 2:211960947-211960969 ATGTGTACCATAATAATGTAAGG + Intronic
946798350 2:223381671-223381693 ATGTACACCTTAATAATTTTTGG - Intergenic
1176992403 21:15513629-15513651 ATATTCACATGAATAATCTTTGG - Intergenic
1177015821 21:15785551-15785573 ATATGCACCTTAATAACCAATGG + Intronic
1177547337 21:22575945-22575967 ACGTCCACCATAATTATCTAAGG - Intergenic
1184725077 22:46339716-46339738 ATGGTCACCTAAATAATCAACGG + Intronic
951128050 3:19007299-19007321 CTGTTCATCTTAATAATCCCTGG + Intergenic
954975637 3:54691633-54691655 ATTTTCATGTTAATAAACTAAGG - Intronic
955013035 3:55038257-55038279 ATGTTCACCTTAATAATCTAAGG - Intronic
956535945 3:70276927-70276949 ATGTTCACTTTATTAATGTGAGG - Intergenic
957401214 3:79716249-79716271 ATATTAACCATAATAATTTAAGG + Intronic
958054153 3:88387581-88387603 ATCATTACCATAATAATCTATGG + Intergenic
959339125 3:105105794-105105816 ATGATCACCTGAATTACCTATGG - Intergenic
959388981 3:105749417-105749439 AAGTCAACCTTAATACTCTAAGG - Intronic
960375717 3:116899212-116899234 AAGTTCACCTGAATAATCTGGGG + Intronic
962727595 3:138247771-138247793 ATCTTCAGCTTAATATTCTCTGG - Intronic
964779254 3:160317066-160317088 ATTTTCAAGATAATAATCTAGGG + Intronic
965095916 3:164225879-164225901 AATGTCACATTAATAATCTAAGG + Intergenic
967466760 3:189815214-189815236 ATGTTCTCCATATTAATTTATGG - Intronic
969287580 4:6214124-6214146 ATGTTCACTTTAATATAGTAGGG + Intergenic
971801249 4:31294576-31294598 AGGCTCACCTGGATAATCTAGGG - Intergenic
976192807 4:82504502-82504524 ATGTAAACCTTAATAGTATATGG - Intronic
978040279 4:104052156-104052178 ACGTTCAGCTTAAGTATCTAAGG - Intergenic
979511890 4:121563755-121563777 ATTTTCACAATAATAATCAATGG + Intergenic
983431611 4:167658318-167658340 ATTTATACCTTAAAAATCTAGGG - Intergenic
984522220 4:180815768-180815790 ATTTTCACATAAAGAATCTAAGG - Intergenic
987289366 5:16494071-16494093 ATGTTCACATAAATAATCAGAGG + Intronic
987295763 5:16549730-16549752 ATGTTCAGCTTAATAAGCTATGG + Intronic
987690160 5:21255800-21255822 ATATGCCCCTTAATAATATAGGG - Intergenic
988045027 5:25939650-25939672 ACTTTCACATTAATAATCCAGGG + Intergenic
989420438 5:41233415-41233437 ATGTTCACTTTAGAACTCTAAGG + Intronic
991534259 5:67649199-67649221 ATGTTCTCCTTACCAGTCTAGGG - Intergenic
992053981 5:72969201-72969223 ATCTTTACCTTGATAATATAGGG + Intronic
992518411 5:77521471-77521493 ATTTTCACCATAATCATCTAGGG - Intronic
992834551 5:80627272-80627294 ATATTCACCCAAATAATCAAGGG - Exonic
992969102 5:82037168-82037190 TTATTCACCTAAATAATCTAAGG - Intronic
996642088 5:125768042-125768064 AAATTCTCCTGAATAATCTATGG - Intergenic
1002871124 6:1168194-1168216 TTGTACACCATAATAATATACGG + Intergenic
1009426585 6:63520712-63520734 TTGTTCACCTTATAAATCTGTGG + Intergenic
1009720733 6:67466104-67466126 TTGTTCACTTTTATAATCTTGGG - Intergenic
1010972348 6:82276274-82276296 ATGTTCTCCTTTATAAAATAGGG - Intergenic
1012419045 6:99042316-99042338 ATGTTCACATTGATAATACATGG - Intergenic
1012846953 6:104402358-104402380 ATGTTCTCATTAATATGCTATGG + Intergenic
1017254795 6:152321542-152321564 ATGTTCACTTTAAAAAACAAAGG + Intronic
1017608651 6:156160720-156160742 GTGTTCACCATACTAAACTAGGG + Intergenic
1020588828 7:10108149-10108171 ATGTTCAACTTATTAATCAGAGG - Intergenic
1022756158 7:33292615-33292637 ATTATCACCTTAATTATATATGG - Intronic
1028856580 7:95599956-95599978 ATTTTAACTTTAATATTCTATGG - Intergenic
1030243239 7:107352578-107352600 ATGTTCAACTTATTTATCTATGG - Intronic
1031223889 7:119009549-119009571 ATCTTTACCTTAATATTTTATGG + Intergenic
1031651359 7:124294272-124294294 ATGTTCACCTTACAAATCTGTGG - Intergenic
1034651204 7:152691942-152691964 ATGCTTACCTTAATAAATTATGG + Intergenic
1035425593 7:158770204-158770226 ATATTCACTTTTATAACCTAAGG + Intronic
1038867263 8:31453173-31453195 ATGTTCACATTGATAATACATGG - Intergenic
1041592534 8:59605718-59605740 ATGTTTACATTAAAAATCCATGG + Intergenic
1042718036 8:71796236-71796258 ATGTTCAGCTCAATATTTTAAGG - Intergenic
1044014879 8:87039239-87039261 ATGCTAACTTTAATATTCTATGG + Intronic
1044880871 8:96720934-96720956 ATGAACACCTTATTAATCTTTGG - Intronic
1047161123 8:122380756-122380778 ATGTACAGGTTAGTAATCTAAGG - Intergenic
1047608712 8:126499856-126499878 ATGTTCATCTTTATAATGCAGGG + Intergenic
1051820828 9:21165506-21165528 ATGTTCACCTGGATATCCTAAGG + Intergenic
1055085143 9:72306135-72306157 ATGTTCACCTGAATAATTTAGGG - Intergenic
1055910499 9:81345068-81345090 TTGTTCACCTCAATCATCCATGG - Intergenic
1056952374 9:91052613-91052635 ATGTTCCCATTAATAGTATATGG + Intergenic
1058975346 9:110121137-110121159 ATTTTCCCCTTAATAAATTAAGG + Intronic
1059943458 9:119381090-119381112 ATGTTCACCTTAAAAATATCAGG + Intergenic
1186530536 X:10290696-10290718 ATGTTGACCTTAAAAAAGTAGGG - Intergenic
1187027930 X:15455412-15455434 ATGTCCAACTTAGTAATGTAAGG - Intronic
1188170282 X:26916322-26916344 CTGTTCTCCTAAATAATCAAGGG - Intergenic
1188226034 X:27598724-27598746 GTGATCACCTTAATAATTAAAGG + Intronic
1188798182 X:34492632-34492654 ATGATCACCTTCATAAAATAAGG + Intergenic
1190650943 X:52568223-52568245 GTGATCACCTTAATAATAAAGGG - Intergenic
1194940687 X:100006160-100006182 ATGTTCAACTTAATATTCTTTGG - Intergenic
1195434870 X:104830670-104830692 ATGGTCACCTAAATAATAAATGG - Intronic
1196086472 X:111688400-111688422 ATCTTTAGCTTTATAATCTAAGG + Intronic
1196155854 X:112429131-112429153 ATGATCACCTTAAACATCAATGG - Intergenic
1198762247 X:140044660-140044682 ATCTTCATCTTAAAATTCTATGG + Intergenic
1199165836 X:144674002-144674024 ATGTTCACAGTGATTATCTATGG - Intergenic
1201458800 Y:14200229-14200251 ATGTTCACATTTATTATCAAGGG + Intergenic