ID: 955014438

View in Genome Browser
Species Human (GRCh38)
Location 3:55056048-55056070
Sequence TTGGATACTGACCCTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955014438 Original CRISPR TTGGATACTGACCCTTTTTC TGG (reversed) Intronic
903392014 1:22971330-22971352 TTAAATACTGACCCATCTTCGGG - Intergenic
908502201 1:64754886-64754908 TTGGGTAGTGATCCTTTATCTGG + Intronic
911241694 1:95474844-95474866 TTGGATACAAACCCTTTTCCTGG - Intergenic
911870632 1:103093647-103093669 TTGGACAAGAACCCTTTTTCTGG + Intronic
912943379 1:114064882-114064904 TTGGGTTGTGACTCTTTTTCAGG + Intergenic
915813746 1:158944928-158944950 TTGGATGCTGACTCTGTTCCTGG - Exonic
916944709 1:169714728-169714750 TTGGATATTAGCCCTTTGTCAGG - Intronic
918281966 1:183015714-183015736 TTGGATATAGTCCCCTTTTCTGG - Intergenic
918793492 1:188860628-188860650 TTGAATATTAACCCTTTATCAGG - Intergenic
919125476 1:193387821-193387843 TTGGATAGTAACCCCTTATCAGG + Intergenic
920273054 1:204781476-204781498 CAGGATACTCGCCCTTTTTCTGG - Intergenic
920935687 1:210432312-210432334 TTCGTTACTGACTCCTTTTCCGG - Intronic
921133685 1:212241510-212241532 TTGGATACTCAACCTTTCTATGG - Intergenic
922940493 1:229460489-229460511 TTGGATAGTAACCCCTTCTCAGG + Intronic
923736235 1:236610600-236610622 TTGGAAATTGGCTCTTTTTCTGG - Intergenic
923998215 1:239520780-239520802 TTTGATATTGACCCTGTTTTAGG + Intronic
924793120 1:247271225-247271247 CTGGATATTAACCCTTTGTCAGG + Intergenic
1064738424 10:18407593-18407615 CTGGAAACTGCCCCTTTTTTTGG + Intronic
1068413087 10:56683279-56683301 TTGGAAATTAACCCTTTATCAGG - Intergenic
1073781313 10:106841778-106841800 TTGAATAATGTCCCTTTGTCTGG + Intronic
1075078179 10:119365504-119365526 TGGCATACAGACCCTTATTCAGG - Intronic
1077951834 11:6967677-6967699 CTGGATATTAGCCCTTTTTCAGG + Intronic
1080651607 11:34227034-34227056 TTGGAGACAGAGTCTTTTTCAGG - Intronic
1080822869 11:35824056-35824078 TGGGAGACTGAGCCTGTTTCTGG - Intergenic
1081921753 11:46784673-46784695 TATGATACTGATCCTTGTTCAGG - Exonic
1086224270 11:84488654-84488676 TTGGATTCTAGCCCATTTTCTGG - Intronic
1086863209 11:91949401-91949423 TTGAATATTCACCATTTTTCTGG + Intergenic
1087043520 11:93824565-93824587 TTGGATATTAACCCCTTTCCAGG + Intronic
1087984881 11:104665515-104665537 TTGGATAATAGTCCTTTTTCAGG - Intergenic
1095336668 12:41036740-41036762 TTGTATATAGACCTTTTTTCTGG + Intronic
1098609565 12:72438667-72438689 TTGGATATTAACCCTTTATCAGG + Intronic
1099023319 12:77433720-77433742 TTGCAGACTGACCTTTTTCCAGG - Intergenic
1100127437 12:91445585-91445607 TTGGATATTAACCCTTTATAAGG - Intergenic
1107350493 13:39509257-39509279 TTGGATACAAATCCTTTATCGGG + Intronic
1107397790 13:40035441-40035463 TTGAATACTGATGCCTTTTCAGG + Intergenic
1108175529 13:47788809-47788831 TTGGATATTAACCCCTTATCAGG - Intergenic
1108396433 13:49996214-49996236 GGGGATACTGAACCCTTTTCTGG + Intronic
1108491813 13:50989776-50989798 TTGAATAATGACCCTTTTTCAGG + Intergenic
1108946790 13:56036598-56036620 TTGGATATTAGACCTTTTTCAGG - Intergenic
1109327082 13:60880644-60880666 TACGATCCTGACCTTTTTTCGGG + Intergenic
1109584902 13:64386910-64386932 TTGGATGCTAAATCTTTTTCTGG - Intergenic
1109853184 13:68094670-68094692 TTTGATAGATACCCTTTTTCAGG - Intergenic
1110530793 13:76595319-76595341 CTGGATATTAACCCTTTGTCAGG - Intergenic
1112330444 13:98473525-98473547 TTGGCTGTTGACCCTTTTCCTGG - Intronic
1114896864 14:27001554-27001576 TTGGATTCAAACTCTTTTTCTGG - Intergenic
1115825790 14:37272448-37272470 TTGGTAACTGACCCTTTCTTTGG + Intronic
1116266986 14:42704968-42704990 TTGGATTTGGACACTTTTTCTGG - Intergenic
1117531823 14:56667127-56667149 CTGGATACTGACCATGTTTCAGG - Intronic
1120343920 14:83259479-83259501 TTGAATAATGACCCTTTTTCAGG + Intergenic
1121177080 14:91898649-91898671 GAGGATACTGACCCTTGCTCAGG - Intronic
1121294153 14:92803798-92803820 TTGAATCCTTACCCTGTTTCTGG + Intronic
1122582484 14:102779351-102779373 TTGGATGCTGTCCCTTCTTTTGG + Intronic
1127016635 15:54696032-54696054 TTGAATACTTACCTTTTCTCAGG + Intergenic
1127316621 15:57801097-57801119 TTGGATATTAGCCCTTTATCAGG + Intergenic
1127628448 15:60803173-60803195 TTGGATAATGTCACTTGTTCAGG + Intronic
1127723643 15:61726494-61726516 ATGTTTACTGACCCTTGTTCCGG - Intergenic
1128203908 15:65833490-65833512 TTTGATACTCACCCTTCTTAAGG - Intronic
1137894473 16:52196168-52196190 CTGGATACTAGCCCTTTGTCAGG + Intergenic
1140832915 16:78768126-78768148 TTGGATTTTGTCCCTTTTTTAGG + Intronic
1145036073 17:19541438-19541460 TTGGATAATGAGCTTATTTCTGG - Intronic
1146811977 17:35911164-35911186 GTGGAGACTGATCCTTTTCCCGG - Intergenic
1148594341 17:48840795-48840817 TTGGATTGGGACCCTTTTTAAGG + Intronic
1156845349 18:41659353-41659375 TTGAATACTGACTATTTTCCAGG - Intergenic
1158385519 18:56986204-56986226 TTGGAAACAGACCCTAGTTCAGG - Intronic
1162121341 19:8471143-8471165 TTGGAAACAGAGCCTTGTTCCGG - Intronic
1162564105 19:11435678-11435700 GTGGATACTGACCTTTGCTCCGG + Intronic
1164617678 19:29676612-29676634 TTTGATACTGACCCCTTGGCCGG - Intergenic
1168182167 19:54669258-54669280 TTGCATATTAACCCTTTATCAGG + Exonic
925997271 2:9303789-9303811 TTGGATACTGTTTCTTTTTGGGG + Intronic
926981268 2:18572548-18572570 TTGGATACTCATCCTTTATCAGG - Intronic
927067079 2:19483580-19483602 TTAGTTATTGACCCTTTATCAGG + Intergenic
928898044 2:36287390-36287412 TTATATACTGAGCCTTATTCAGG - Intergenic
929475936 2:42248583-42248605 TTGGTTAATGGCTCTTTTTCTGG + Intronic
929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG + Intronic
929940366 2:46329213-46329235 TTGGTTACTGACTCTGGTTCAGG + Intronic
935085499 2:99840742-99840764 TTGGAACCTGATCCTTTTCCAGG + Intronic
935702644 2:105825585-105825607 TTCTCTGCTGACCCTTTTTCAGG - Intronic
936487097 2:112935273-112935295 TTGGATGCTGTACCTTTTTAAGG - Intergenic
938691696 2:133796894-133796916 TTGGATATTTACCCTTTATTGGG + Intergenic
939622141 2:144433254-144433276 TTGGATACTGATGCTGTTTTTGG - Intronic
940363138 2:152817197-152817219 TTGGTTACGGACACTGTTTCAGG - Intergenic
942809185 2:179976513-179976535 TTGGATATTAACCCCTTATCAGG - Intronic
944258567 2:197651154-197651176 CTGGATATTAACCCTTTATCAGG + Intronic
944362245 2:198870675-198870697 TTGAACACTGGCCATTTTTCAGG - Intergenic
946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG + Intronic
946404717 2:219486236-219486258 TTGAGTAATGCCCCTTTTTCAGG - Intronic
948923095 2:241075595-241075617 TTTGATACTGATCCTTTGTCAGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1168919346 20:1518173-1518195 CTGAATAGGGACCCTTTTTCTGG + Intergenic
1169467871 20:5857414-5857436 TGGGAAGCTGTCCCTTTTTCAGG - Intronic
1171511701 20:25690863-25690885 TTGCAGACTGACTCTTTTCCAGG - Intronic
1171820861 20:29836581-29836603 TTGGAGACTCCCCATTTTTCAGG - Intergenic
1172493371 20:35359843-35359865 TGGCACACTGACCCTTTTCCAGG + Intronic
1173499489 20:43542246-43542268 TTGGATACAGACACTCTTCCAGG - Intronic
1176193197 20:63823721-63823743 GTGGATATTGTCCTTTTTTCTGG - Intronic
1178130651 21:29569085-29569107 TTGGGCACTGACACTTCTTCTGG + Intronic
1179305573 21:40151166-40151188 TGGGATCCCCACCCTTTTTCAGG - Intronic
1180324895 22:11361521-11361543 TTGGAGACTCCCCATTTTTCAGG - Intergenic
1181980899 22:26765563-26765585 TTGGATACTTACCCTATGCCAGG - Intergenic
1181989254 22:26824674-26824696 TTGGATATTAACCCCTTATCTGG + Intergenic
1182019853 22:27072372-27072394 TTGGATTCTGACCGTGTATCAGG - Intergenic
1182071404 22:27466321-27466343 TGGGGGACTGACCCTTGTTCTGG - Intergenic
1184623369 22:45700944-45700966 TTGGATCCTGGTACTTTTTCTGG + Intronic
1184885222 22:47340738-47340760 CTGGATACTGACCTTGTTTGTGG - Intergenic
953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG + Intronic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
955168918 3:56543890-56543912 CTGGATATTAGCCCTTTTTCCGG - Intergenic
956301444 3:67776496-67776518 TTGGATATTAGCCCTTTGTCAGG + Intergenic
957686314 3:83506869-83506891 TTGGTTACTAATCCTTTGTCAGG - Intergenic
959369835 3:105509613-105509635 TTGGATATCAACCCTTTATCAGG + Intronic
960211004 3:114965897-114965919 TTGGATATTAACCCCTTATCAGG + Intronic
962513966 3:136131267-136131289 TTGGATATTAGCCCTTTGTCAGG - Intronic
966459579 3:180161303-180161325 TTGGCTACTCAGGCTTTTTCTGG + Intergenic
967825741 3:193876014-193876036 TTTGATCCTGCCCCTTTTTCTGG - Intergenic
970626510 4:17890806-17890828 TTGAATACTGACACTTTATTGGG + Intronic
973224712 4:47770109-47770131 TTGGATATTAACCCCTTATCAGG - Intronic
974258676 4:59496191-59496213 TTGGCCACTGATCCTTTTACAGG + Intergenic
974963904 4:68736473-68736495 TTAGGGACTGACTCTTTTTCAGG + Intergenic
975212485 4:71717318-71717340 CTGGATACTAGCCCTTTGTCAGG + Intergenic
975360634 4:73466535-73466557 TTGGATACTAACCCTGTGTCAGG - Intergenic
976627255 4:87199604-87199626 CTGGATATTAACCCCTTTTCAGG - Intronic
976690180 4:87860446-87860468 CTGGATACAGATCTTTTTTCTGG + Intergenic
978412765 4:108443113-108443135 GTGGTAACAGACCCTTTTTCTGG - Intergenic
979024675 4:115553846-115553868 ATGGATACTGGGCCATTTTCAGG + Intergenic
981710317 4:147702655-147702677 TTAGATTCTGTCACTTTTTCTGG - Intergenic
982792138 4:159605577-159605599 TTGGTTTCTGATTCTTTTTCAGG + Intergenic
986137650 5:4997724-4997746 TTGGGTATTGACCCTTTATTGGG + Intergenic
987479673 5:18437756-18437778 TTGGAGACAGAGCCTTTTTGAGG + Intergenic
989508391 5:42255126-42255148 CTGGATACTATCCCTTTGTCAGG + Intergenic
990829821 5:59943736-59943758 CTGGACTCTGACCCTTTTTTAGG + Intronic
990857861 5:60290911-60290933 TTGGCTTGTGACCCTTTTTTGGG - Intronic
990920967 5:60966261-60966283 TTGGATATTAACCCTTTATCAGG + Intronic
991153276 5:63397903-63397925 TTGGATTCTGTCACTTTCTCAGG + Intergenic
991243708 5:64487296-64487318 TTGCATACTTACCATTTTTGTGG + Intergenic
993783850 5:92103876-92103898 TTTTATGCTGACCCTTTTTCTGG + Intergenic
995167006 5:109055413-109055435 TTGGATATTAACCCCTTATCAGG - Intronic
995720187 5:115122494-115122516 CTGGATATTAACCCTTTGTCAGG - Intergenic
996341699 5:122445547-122445569 TTGAATACTGACTGATTTTCAGG - Intronic
997004014 5:129797585-129797607 CTGGATACTAGCCCTTTGTCAGG + Intergenic
999107035 5:149082269-149082291 TTGGATATTAACCCCTTATCAGG - Intergenic
1000582980 5:163056567-163056589 TTGGTTATTGATCCTTTCTCAGG + Intergenic
1001167758 5:169386243-169386265 CTGGATATTGGCCCTTTGTCAGG - Intergenic
1005578659 6:27213068-27213090 TTGGATACTGATGCTTTGTGTGG - Intergenic
1005578848 6:27214683-27214705 TTGGATACTGATGCTTTGTGTGG - Intergenic
1005868900 6:29958515-29958537 CTGGGTACTGTCCCTGTTTCGGG - Intergenic
1006825048 6:36928614-36928636 TTGGTTACTGACCCTTCCCCAGG - Intronic
1006827217 6:36944410-36944432 CTGGAAACTGACCCCTTCTCGGG - Intergenic
1011011422 6:82707799-82707821 TTGGATATTAACCCTTTATCAGG + Intergenic
1011978922 6:93346609-93346631 TTGAATACAGTCTCTTTTTCTGG - Intronic
1013321619 6:108996375-108996397 TTGGTTACTGACTCTATGTCAGG - Intronic
1013515361 6:110880274-110880296 TTGGATATTGACCCCTTATGAGG + Intronic
1014105854 6:117559637-117559659 TTCAATAATGAACCTTTTTCAGG - Intronic
1014716809 6:124875247-124875269 TTGGATACTAGACCTTTGTCAGG - Intergenic
1014792910 6:125694663-125694685 TTTGGTTCTGACCTTTTTTCTGG - Intergenic
1015664453 6:135612154-135612176 TTGGCTATTAACCCTTTATCAGG + Intergenic
1018188056 6:161285251-161285273 TTGTATACTCACCCTGTTCCGGG + Intergenic
1018419122 6:163626803-163626825 CTGGATGCTGACCCTCTCTCAGG - Intergenic
1018946748 6:168352603-168352625 TTGGATACTAACCCTTGATATGG - Intergenic
1020350700 7:7215510-7215532 TTGGAAAATTAGCCTTTTTCAGG + Intronic
1022378344 7:29836013-29836035 TTGGACACTGACCCTATCTGAGG + Intronic
1024048044 7:45598610-45598632 TTGGTAACTCACACTTTTTCTGG - Intronic
1026531605 7:71203533-71203555 TTGGATATTAACCCCTTGTCAGG + Intronic
1029044340 7:97612256-97612278 TGGGAACCTGACCATTTTTCAGG + Intergenic
1029173776 7:98649276-98649298 CTGGATTGAGACCCTTTTTCTGG + Intergenic
1030726279 7:112929187-112929209 TTGGATATTAACCCCTTATCAGG - Intronic
1030871659 7:114763662-114763684 CTGGATACTAGCCCTTTGTCAGG - Intergenic
1031104108 7:117517941-117517963 TTGGATATTAGCCCTTTGTCAGG + Intronic
1031675835 7:124610684-124610706 TTGGTTTCTGTCCCTTTTTTTGG - Intergenic
1032607128 7:133367647-133367669 CTGGAGACTGTCCCTTTTTAGGG - Intronic
1033377492 7:140776466-140776488 CTGCATTCTGACCCTTTTTGAGG - Intronic
1033939971 7:146640674-146640696 ATGGATACTGACTCTTTTACAGG - Intronic
1038112832 8:24518485-24518507 TTTTCTACTGACCCTTGTTCTGG - Intronic
1038193632 8:25346441-25346463 TTGGACACTGATACTTTCTCTGG + Intronic
1039188900 8:34949638-34949660 TTGGATACCTACTATTTTTCAGG - Intergenic
1039830820 8:41212584-41212606 CTGGATACGCACCTTTTTTCAGG - Intergenic
1040516174 8:48136896-48136918 TGGGATAACAACCCTTTTTCAGG - Intergenic
1040531958 8:48273339-48273361 CTGGATATTGGCCCTTTGTCAGG - Intergenic
1041841668 8:62279262-62279284 CTGGATATTAGCCCTTTTTCAGG + Intronic
1042684758 8:71425800-71425822 TGGAATACTGCCCCTCTTTCAGG - Intronic
1042690149 8:71489186-71489208 TTGGTTTGTGACTCTTTTTCTGG + Intronic
1042767180 8:72335784-72335806 TTGAATAATAGCCCTTTTTCTGG + Intergenic
1042815102 8:72869446-72869468 TTGGATATTAATCCTTTATCAGG - Intronic
1043167876 8:76926852-76926874 TTGGGTTCTTACCCTTTTCCTGG - Intergenic
1044293348 8:90498825-90498847 TGGGATATTGACCCTTTATCAGG - Intergenic
1045360751 8:101430971-101430993 CTGGATATTGGCCCTTTGTCAGG - Intergenic
1047935581 8:129774665-129774687 TTAGATATTAACCCTTTATCAGG - Intronic
1048050269 8:130809770-130809792 TTGGATTCTAACCCCTTTTGAGG - Intronic
1048208636 8:132435967-132435989 TTGGACACTGCCTCTCTTTCAGG - Intronic
1048241319 8:132744186-132744208 TTGGACACTTACCATTTTCCAGG - Intronic
1049333241 8:142066856-142066878 TTGGATCTTAACCCTTTTTAGGG - Intergenic
1050850197 9:10275615-10275637 ATGGATACTGGCCCCTTTTTTGG - Intronic
1050870302 9:10559659-10559681 CTGGATATTAGCCCTTTTTCAGG - Intronic
1050880720 9:10696721-10696743 TTGGATACAGAATCCTTTTCAGG - Intergenic
1052444139 9:28537837-28537859 TTTGATACTGACACTTTTTCAGG - Intronic
1052554204 9:29992802-29992824 TTGGATATTAGCCCTTTGTCAGG + Intergenic
1052654831 9:31344366-31344388 TTGTATATTGACCTTTTATCTGG + Intergenic
1055021739 9:71677491-71677513 TTGGTAACTGACCCTCTTCCTGG + Intergenic
1057751304 9:97795615-97795637 TGGGACATTGACTCTTTTTCTGG - Intergenic
1058267066 9:102914496-102914518 TTGGATATTGACCCCTTGTCAGG - Intergenic
1058455547 9:105134832-105134854 CTGGATGCGGACCCCTTTTCTGG + Intergenic
1058743783 9:107969748-107969770 TTGGATTCTGACCCTCTTTCTGG - Intergenic
1059092236 9:111371891-111371913 TTGGTCACTGACTTTTTTTCAGG - Intronic
1059790359 9:117635945-117635967 TTGGAGCCTGACCATCTTTCAGG - Intergenic
1060488886 9:124067404-124067426 TTGGGTACTTACCCTATGTCAGG + Intergenic
1061558268 9:131385666-131385688 TTGTTTACTGAGCATTTTTCTGG - Intergenic
1203372545 Un_KI270442v1:322089-322111 TTGGAGACTCCCCATTTTTCAGG - Intergenic
1186663122 X:11689553-11689575 TTGGATATTAACCCCTTATCAGG - Intergenic
1187030143 X:15478479-15478501 CTGGATTCTGACCCTGTTCCTGG - Intronic
1188559623 X:31452944-31452966 TTGAATACTGACCCCTTACCGGG - Intronic
1189632876 X:42974005-42974027 TTTGTTACTGACCATTTTACTGG + Intergenic
1190592727 X:52021322-52021344 CTGGATATTAACCCTTTGTCAGG + Intergenic
1190936488 X:55002922-55002944 TTTGAAACTGACCCCTTTTGGGG + Intronic
1192929200 X:75786969-75786991 TTGTATGCTGATCCTTTTTTCGG + Intergenic
1194382241 X:93208557-93208579 TTGGATATTAACCCCTTATCAGG - Intergenic
1195588413 X:106594452-106594474 TTGTATACTGACCTTATATCTGG + Intergenic
1195915871 X:109934950-109934972 ATGGATACTGACCCTTTCCCAGG - Intergenic
1197166449 X:123382684-123382706 TTGCCTAATTACCCTTTTTCTGG - Intronic
1197352498 X:125395302-125395324 GTGGATACTGATCCTGTTTTGGG + Intergenic
1198890021 X:141383780-141383802 TTGAATATTAACCCTTTATCAGG - Intergenic
1200054342 X:153450937-153450959 TTTGATGCTGACCCTTTCTCTGG + Intronic
1200848531 Y:7858266-7858288 TTCCATTCTGAACCTTTTTCTGG + Intergenic
1201488611 Y:14517775-14517797 TGGGACAATGACCCTATTTCAGG + Intergenic