ID: 955014540

View in Genome Browser
Species Human (GRCh38)
Location 3:55057199-55057221
Sequence GACTCACGGTTCCACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955014540_955014545 16 Left 955014540 3:55057199-55057221 CCAGCCACGTGGAACCGTGAGTC 0: 11
1: 635
2: 4748
3: 7908
4: 8118
Right 955014545 3:55057238-55057260 TTTATAAATTATCCAGTCTCAGG 0: 575
1: 7750
2: 14082
3: 14112
4: 10506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955014540 Original CRISPR GACTCACGGTTCCACGTGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr