ID: 955017888

View in Genome Browser
Species Human (GRCh38)
Location 3:55089602-55089624
Sequence AACACTGCTCTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955017888_955017889 -1 Left 955017888 3:55089602-55089624 CCAGTCAGCAGCAGAGCAGTGTT No data
Right 955017889 3:55089624-55089646 TCATATCCTTCTCTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955017888 Original CRISPR AACACTGCTCTGCTGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr