ID: 955023885

View in Genome Browser
Species Human (GRCh38)
Location 3:55148398-55148420
Sequence AAGCCAGGCATCCCGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955023881_955023885 9 Left 955023881 3:55148366-55148388 CCGCAATAGGCTATTTGCGATCC No data
Right 955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG No data
955023880_955023885 19 Left 955023880 3:55148356-55148378 CCAGCTAAAGCCGCAATAGGCTA No data
Right 955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955023885 Original CRISPR AAGCCAGGCATCCCGGAGCC TGG Intergenic
No off target data available for this crispr