ID: 955023957

View in Genome Browser
Species Human (GRCh38)
Location 3:55149086-55149108
Sequence CTGTTCACTGCTTCCTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955023957_955023959 -10 Left 955023957 3:55149086-55149108 CCATAGAAGGAAGCAGTGAACAG No data
Right 955023959 3:55149099-55149121 CAGTGAACAGAGTTTGGAAAAGG No data
955023957_955023962 25 Left 955023957 3:55149086-55149108 CCATAGAAGGAAGCAGTGAACAG No data
Right 955023962 3:55149134-55149156 GTCACAGCAGCCCTTGTACGTGG No data
955023957_955023960 -7 Left 955023957 3:55149086-55149108 CCATAGAAGGAAGCAGTGAACAG No data
Right 955023960 3:55149102-55149124 TGAACAGAGTTTGGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955023957 Original CRISPR CTGTTCACTGCTTCCTTCTA TGG (reversed) Intergenic
No off target data available for this crispr