ID: 955025156

View in Genome Browser
Species Human (GRCh38)
Location 3:55160511-55160533
Sequence ACGTCTTCACATAAGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955025156_955025157 -8 Left 955025156 3:55160511-55160533 CCGGGCTGCTTATGTGAAGACGT No data
Right 955025157 3:55160526-55160548 GAAGACGTCCACTCACATCCTGG No data
955025156_955025162 27 Left 955025156 3:55160511-55160533 CCGGGCTGCTTATGTGAAGACGT No data
Right 955025162 3:55160561-55160583 CCCTCATTAAGCAACCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955025156 Original CRISPR ACGTCTTCACATAAGCAGCC CGG (reversed) Intergenic
No off target data available for this crispr