ID: 955025156 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:55160511-55160533 |
| Sequence | ACGTCTTCACATAAGCAGCC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955025156_955025157 | -8 | Left | 955025156 | 3:55160511-55160533 | CCGGGCTGCTTATGTGAAGACGT | No data | ||
| Right | 955025157 | 3:55160526-55160548 | GAAGACGTCCACTCACATCCTGG | No data | ||||
| 955025156_955025162 | 27 | Left | 955025156 | 3:55160511-55160533 | CCGGGCTGCTTATGTGAAGACGT | No data | ||
| Right | 955025162 | 3:55160561-55160583 | CCCTCATTAAGCAACCCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955025156 | Original CRISPR | ACGTCTTCACATAAGCAGCC CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||