ID: 955025967

View in Genome Browser
Species Human (GRCh38)
Location 3:55167784-55167806
Sequence AGATACACCTCCAGATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955025967_955025971 25 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025971 3:55167832-55167854 TGCAGCTGGGACAAGGCCAAAGG No data
955025967_955025970 18 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025970 3:55167825-55167847 GCAGAGCTGCAGCTGGGACAAGG No data
955025967_955025972 26 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025972 3:55167833-55167855 GCAGCTGGGACAAGGCCAAAGGG No data
955025967_955025969 12 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG No data
955025967_955025968 11 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025968 3:55167818-55167840 TCAAACTGCAGAGCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955025967 Original CRISPR AGATACACCTCCAGATAGAG AGG (reversed) Intergenic
No off target data available for this crispr