ID: 955025969

View in Genome Browser
Species Human (GRCh38)
Location 3:55167819-55167841
Sequence CAAACTGCAGAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955025967_955025969 12 Left 955025967 3:55167784-55167806 CCTCTCTATCTGGAGGTGTATCT No data
Right 955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG No data
955025966_955025969 13 Left 955025966 3:55167783-55167805 CCCTCTCTATCTGGAGGTGTATC No data
Right 955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955025969 Original CRISPR CAAACTGCAGAGCTGCAGCT GGG Intergenic
No off target data available for this crispr