ID: 955026607

View in Genome Browser
Species Human (GRCh38)
Location 3:55173639-55173661
Sequence TGCCAATGTTAGAGAGGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955026603_955026607 -2 Left 955026603 3:55173618-55173640 CCCTGTGATTGTAATAGTCCTTG No data
Right 955026607 3:55173639-55173661 TGCCAATGTTAGAGAGGCCACGG No data
955026602_955026607 -1 Left 955026602 3:55173617-55173639 CCCCTGTGATTGTAATAGTCCTT No data
Right 955026607 3:55173639-55173661 TGCCAATGTTAGAGAGGCCACGG No data
955026604_955026607 -3 Left 955026604 3:55173619-55173641 CCTGTGATTGTAATAGTCCTTGC No data
Right 955026607 3:55173639-55173661 TGCCAATGTTAGAGAGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955026607 Original CRISPR TGCCAATGTTAGAGAGGCCA CGG Intergenic
No off target data available for this crispr