ID: 955027947

View in Genome Browser
Species Human (GRCh38)
Location 3:55188564-55188586
Sequence TTTAAGATGGATTTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955027944_955027947 -4 Left 955027944 3:55188545-55188567 CCCAGCTGGTGATTAGGTTTTTA No data
Right 955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG No data
955027941_955027947 4 Left 955027941 3:55188537-55188559 CCACCAAGCCCAGCTGGTGATTA No data
Right 955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG No data
955027943_955027947 1 Left 955027943 3:55188540-55188562 CCAAGCCCAGCTGGTGATTAGGT No data
Right 955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG No data
955027945_955027947 -5 Left 955027945 3:55188546-55188568 CCAGCTGGTGATTAGGTTTTTAA No data
Right 955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955027947 Original CRISPR TTTAAGATGGATTTCTTGAG AGG Intergenic
No off target data available for this crispr